Dataset for CDS BAX of Organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6NSH2_BAX-05      atggacgggtccggggagcagcccagaggcggggggccca---ccagctc
A0A2K6NSH2_BAX-04      atggacgggtccggggagcagcccagaggcgggggagcgacaccccgttc
A0A2K6NSH2_BAX-03      atggacgggtccggggagcagcccagaggcggggggccca---ccagctc
A0A2K6NSH2_BAX-02      atggacgggtccggggagcagcccagaggcggggggccca---ccagctc
A0A2K6NSH2_BAX-01      --------------------------------------------------
                                                                         

A0A2K6NSH2_BAX-05      tgagcagatcatgaagacaggggcccttttgcttcagggtttcatccagg
A0A2K6NSH2_BAX-04      tga-----------------------ttctgcaccctcactccatcccca
A0A2K6NSH2_BAX-03      tgagcagatcatgaagacaggggcccttttgcttcagg------------
A0A2K6NSH2_BAX-02      tgagcagatcatgaagacaggggcccttttgcttcagggtttcatccagg
A0A2K6NSH2_BAX-01      ----------atgaagacaggggcccttttgcttcagggtttcatccagg
                                                 ** ***  *               

A0A2K6NSH2_BAX-05      atcgagcagggcgaatggggggggagacacccgagctggccctggaccca
A0A2K6NSH2_BAX-04      ctcta----ggcgaatggggggggagacacccgagctggccctggaccca
A0A2K6NSH2_BAX-03      --------------------------------------------------
A0A2K6NSH2_BAX-02      atcgagcagggcgaatggggggggagacacccgagctggccctggaccca
A0A2K6NSH2_BAX-01      atcgagcagggcgaatggggggggagacacccgagctggccctggaccca
                                                                         

A0A2K6NSH2_BAX-05      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K6NSH2_BAX-04      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K6NSH2_BAX-03      --------------------------------------------------
A0A2K6NSH2_BAX-02      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K6NSH2_BAX-01      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
                                                                         

A0A2K6NSH2_BAX-05      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K6NSH2_BAX-04      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K6NSH2_BAX-03      -----------------------------------ggatgattgccgccg
A0A2K6NSH2_BAX-02      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K6NSH2_BAX-01      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
                                                          ***************

A0A2K6NSH2_BAX-05      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K6NSH2_BAX-04      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K6NSH2_BAX-03      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K6NSH2_BAX-02      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K6NSH2_BAX-01      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
                       **************************************************

A0A2K6NSH2_BAX-05      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K6NSH2_BAX-04      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K6NSH2_BAX-03      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K6NSH2_BAX-02      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K6NSH2_BAX-01      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
                       **************************************************

A0A2K6NSH2_BAX-05      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K6NSH2_BAX-04      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K6NSH2_BAX-03      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K6NSH2_BAX-02      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K6NSH2_BAX-01      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
                       **************************************************

A0A2K6NSH2_BAX-05      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K6NSH2_BAX-04      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K6NSH2_BAX-03      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K6NSH2_BAX-02      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K6NSH2_BAX-01      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
                       **************************************************

A0A2K6NSH2_BAX-05      ggctggatccaagaccagggtggttgggtgagactcctcaaccctcct--
A0A2K6NSH2_BAX-04      ggctggatccaagaccagggtggttgggacggcctcctc--tcctacttt
A0A2K6NSH2_BAX-03      ggctggatccaagaccagggtggttgggacggcctcctc--tcctacttt
A0A2K6NSH2_BAX-02      ggctggatccaagaccagggtggttgggacggcctcctc--tcctacttt
A0A2K6NSH2_BAX-01      ggctggatccaagaccagggtggttgggacggcctcctc--tcctacttt
                       ****************************   * ******   *** **  

A0A2K6NSH2_BAX-05      ----caccccaaccaccgcccctgccccactgtcccttggtg--------
A0A2K6NSH2_BAX-04      gggacgcccacgtggcagaccgtgacc------atcttggtggctggagt
A0A2K6NSH2_BAX-03      gggacgcccacgtggcagaccgtgacc------atcttggtggctggagt
A0A2K6NSH2_BAX-02      gggacgcccacgtggcagaccgtgacc------atcttggtggctggagt
A0A2K6NSH2_BAX-01      gggacgcccacgtggcagaccgtgacc------atcttggtggctggagt
                           * ***      * * ** ** **        *******        

A0A2K6NSH2_BAX-05      ---------ccctctccccatctttggatcatcagatgtggtctataatg
A0A2K6NSH2_BAX-04      actcaccgcctccctcaccatc--tgga--agaagatggg----------
A0A2K6NSH2_BAX-03      actcaccgcctccctcaccatc--tgga--agaagatggg----------
A0A2K6NSH2_BAX-02      actcaccgcctccctcaccatc--tgga--agaagatggg----------
A0A2K6NSH2_BAX-01      actcaccgcctccctcaccatc--tgga--agaagatggg----------
                                * * *** *****  ****  *  ***** *          

A0A2K6NSH2_BAX-05      catttccttacgtgtct
A0A2K6NSH2_BAX-04      ------ctga-------
A0A2K6NSH2_BAX-03      ------ctga-------
A0A2K6NSH2_BAX-02      ------ctga-------
A0A2K6NSH2_BAX-01      ------ctga-------
                             ** *       

© 1998-2018