Dataset for CDS BAK1 of Organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6N8C5_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K6N8C5_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K6N8C5_BAK1-03      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc

A0A2K6N8C5_BAK1-02      tgccctgccttctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K6N8C5_BAK1-01      tgccctgccttctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K6N8C5_BAK1-03      tgccctgccttctgcttctgaggagcaggtagcccgggacacagaggagg

A0A2K6N8C5_BAK1-02      ttttccgcagctacgttttttaccgccatcagcagaacc-----------
A0A2K6N8C5_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K6N8C5_BAK1-03      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                        *********************************** * *           

A0A2K6N8C5_BAK1-02      ----------cctctgccatgagcca------------------------
A0A2K6N8C5_BAK1-01      ggggcggctgcccctgcc--gacccagagatggtcaccttgcccctgcaa
A0A2K6N8C5_BAK1-03      ggggcggctgcccctgcc--gacccagagatggtcaccttgcccctgcaa
                                  ** *****  ** ***                        

A0A2K6N8C5_BAK1-02      --------------aggcctggtgggacggcagctcgccatcatcgggga
A0A2K6N8C5_BAK1-01      cctagcagcaccatgggacaggtgggacggcagctcgccatcatcgggga
A0A2K6N8C5_BAK1-03      cctagcagcaccatgggacaggtgggacggcagctcgccatcatcgggga
                                       ** * ******************************

A0A2K6N8C5_BAK1-02      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc
A0A2K6N8C5_BAK1-01      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc
A0A2K6N8C5_BAK1-03      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc

A0A2K6N8C5_BAK1-02      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctc-
A0A2K6N8C5_BAK1-01      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctc-
A0A2K6N8C5_BAK1-03      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctcc

A0A2K6N8C5_BAK1-02      -------------------cagcctgtttgagagtggcatcaactggggc
A0A2K6N8C5_BAK1-01      -------------------cagcctgtttgagagtggcatcaactggggc
A0A2K6N8C5_BAK1-03      aggccagcaacaacacccacagcctgtttgagagtggcatcaactggggc

A0A2K6N8C5_BAK1-02      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta
A0A2K6N8C5_BAK1-01      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta
A0A2K6N8C5_BAK1-03      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta

A0A2K6N8C5_BAK1-02      ccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtcg
A0A2K6N8C5_BAK1-01      ccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtcg
A0A2K6N8C5_BAK1-03      ccagcgcggcctga------------------------------------

A0A2K6N8C5_BAK1-02      atttcatgctgcatcactgcattgcccggtggattgcacagaggggtggc
A0A2K6N8C5_BAK1-01      atttcatgctgcatcactgcattgcccggtggattgcacagaggggtggc
A0A2K6N8C5_BAK1-03      --------------------------------------------------

A0A2K6N8C5_BAK1-02      tgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggt
A0A2K6N8C5_BAK1-01      tgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggt
A0A2K6N8C5_BAK1-03      --------------------------------------------------

A0A2K6N8C5_BAK1-02      ggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttca
A0A2K6N8C5_BAK1-01      ggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttca
A0A2K6N8C5_BAK1-03      --------------------------------------------------

A0A2K6N8C5_BAK1-02      aatcatga
A0A2K6N8C5_BAK1-01      aatcatga
A0A2K6N8C5_BAK1-03      --------

© 1998-2019