Dataset for CDS BAX-like of Organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6MIN3_BAX-04       atggacg-ggtccggggagcagcccag--------aggcggg--------
A0A2K6MIN3_BAX-02       atggacg-ggtccggggagcagcccag--------aggcggg--------
A0A2K6MIN3_BAX-01       atggacg-ggtccggggagcagcccag--------aggcggg--------
A0A2K6MIN3_BAX-03       atggacg-ggtccggggagcagcccag--------aggcggg--------
A0A2K6M2P5_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2K6MNN9_BAK1-02      atg-----gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A2K6MNN9_BAK1-01      atg-----gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A2K6MNN9_BAK1-03      atg-----gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
                        ***     * * ***       **  *         * *  *        

A0A2K6MIN3_BAX-04       ---------------------------gggcccaccagctctgagcagat
A0A2K6MIN3_BAX-02       ---------------------------ggagcgac--accccgttctgat
A0A2K6MIN3_BAX-01       ---------------------------gggcccaccagctctgagcagat
A0A2K6MIN3_BAX-03       ---------------------------gggcccaccagctctgagcagat
A0A2K6M2P5_BOK-01       tgcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaagg
A0A2K6MNN9_BAK1-02      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacac--
A0A2K6MNN9_BAK1-01      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacac--
A0A2K6MNN9_BAK1-03      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacac--
                                                   **  *      * * *  *    

A0A2K6MIN3_BAX-04       catgaagacaggggcccttt----tgcttcagggtttcatccaggatcga
A0A2K6MIN3_BAX-02       tct----------gcaccct----cactccatc------------cccac
A0A2K6MIN3_BAX-01       catgaagacaggggcccttt----tgcttcagggtttcatccaggatcga
A0A2K6MIN3_BAX-03       catgaagacaggggcccttt----tgcttcagg-----------------
A0A2K6M2P5_BOK-01       cgctgggccgggagtacgtgcacgcgcggctac--tgcgcgccggcctct
A0A2K6MNN9_BAK1-02      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
A0A2K6MNN9_BAK1-01      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
A0A2K6MNN9_BAK1-03      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
                                     *            *  *                    

A0A2K6MIN3_BAX-04       gcagg-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6MIN3_BAX-02       tctag-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6MIN3_BAX-01       gcagg-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6MIN3_BAX-03       --------------------------------------------------
A0A2K6M2P5_BOK-01       cctggagc--gcgcccgagcgcgccgc-gccggtcccgggacgcctggcc
A0A2K6MNN9_BAK1-02      gcagaacc---------------------cctctgccatgag-----cca
A0A2K6MNN9_BAK1-01      gcaggaacaggaggctgaaggggcggctgcccctgcc--gac-----cca
A0A2K6MNN9_BAK1-03      gcaggaacaggaggctgaaggggcggctgcccctgcc--gac-----cca

A0A2K6MIN3_BAX-04       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6MIN3_BAX-02       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6MIN3_BAX-01       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6MIN3_BAX-03       --------------------------------------------------
A0A2K6M2P5_BOK-01       gaggtgtgcgcggtgctcctgc------------------gcctgg-ggg
A0A2K6MNN9_BAK1-02      --------------------------------------aggcctggtggg
A0A2K6MNN9_BAK1-01      gagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtggg
A0A2K6MNN9_BAK1-03      gagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtggg

A0A2K6MIN3_BAX-04       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6MIN3_BAX-02       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6MIN3_BAX-01       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6MIN3_BAX-03       --------------------------------------------------
A0A2K6M2P5_BOK-01       atg--agctggagatgatccggcccagcgtctaccg-caacgtggctcgt
A0A2K6MNN9_BAK1-02      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag
A0A2K6MNN9_BAK1-01      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag
A0A2K6MNN9_BAK1-03      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag

A0A2K6MIN3_BAX-04       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6MIN3_BAX-02       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6MIN3_BAX-01       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6MIN3_BAX-03       ----------ggatgat--------tgccgccgtggacacagactccccc
A0A2K6M2P5_BOK-01       cagctgcacatctccctgcag--tctg-agcctgtggtg------accga
A0A2K6MNN9_BAK1-02      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
A0A2K6MNN9_BAK1-01      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
A0A2K6MNN9_BAK1-03      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
                                        *        **  ***   *          **  

A0A2K6MIN3_BAX-04       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6MIN3_BAX-02       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6MIN3_BAX-01       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6MIN3_BAX-03       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6M2P5_BOK-01       tgcg-----ttcctggccgtggctggcca--------------------c
A0A2K6MNN9_BAK1-02      tgag-----tacttcaccaagattgcctc--------------------c
A0A2K6MNN9_BAK1-01      tgag-----tacttcaccaagattgcctc--------------------c
A0A2K6MNN9_BAK1-03      tgag-----tacttcaccaagattgcctccaggccagcaacaacacccac
                         * *     *   *      *   *                        *

A0A2K6MIN3_BAX-04       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6MIN3_BAX-02       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6MIN3_BAX-01       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6MIN3_BAX-03       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6M2P5_BOK-01       atcttctctgca---ggcatcacgtggggcaaggtggtgtc-cttgtatg
A0A2K6MNN9_BAK1-02      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
A0A2K6MNN9_BAK1-01      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
A0A2K6MNN9_BAK1-03      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
                        *   * * **       * ***  ******   ** **  * *** *   

A0A2K6MIN3_BAX-04       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6MIN3_BAX-02       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6MIN3_BAX-01       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6MIN3_BAX-03       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6M2P5_BOK-01       cggtggccgcagggctggccgtggactgtgtgaggcaggcccagcctgcc
A0A2K6MNN9_BAK1-02      cttcggctacc-gtctggccctacac-----------------gtctacc
A0A2K6MNN9_BAK1-01      cttcggctacc-gtctggccctacac-----------------gtctacc
A0A2K6MNN9_BAK1-03      cttcggctacc-gtctggccctacac-----------------gtctacc
                        *   * *  *    ****   *  *                  *  * **

A0A2K6MIN3_BAX-04       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6MIN3_BAX-02       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6MIN3_BAX-01       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6MIN3_BAX-03       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6M2P5_BOK-01       atggtccacgccctcgtggactgcctgggggagtttgtgcgcaagaccct
A0A2K6MNN9_BAK1-02      agcgt----ggcctgactggcttcctgggccaggtgacccgcttcgtggt
A0A2K6MNN9_BAK1-01      agcgt----ggcctgactggcttcctgggccaggtgacccgcttcgtggt
A0A2K6MNN9_BAK1-03      agcgt----ggcctga----------------------------------
                        *  **    *  **                                    

A0A2K6MIN3_BAX-04       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6MIN3_BAX-02       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6MIN3_BAX-01       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6MIN3_BAX-03       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6M2P5_BOK-01       ggcaacctggctgcggagacgcggtg---gatggactgatgtcctcaaat
A0A2K6MNN9_BAK1-02      cgatttcatgctgcatcactgcattgcccggtggattg-----cacagag
A0A2K6MNN9_BAK1-01      cgatttcatgctgcatcactgcattgcccggtggattg-----cacagag
A0A2K6MNN9_BAK1-03      --------------------------------------------------

A0A2K6MIN3_BAX-04       gggtggttgggtgagactcctcaaccctcct------caccccaaccacc
A0A2K6MIN3_BAX-02       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6MIN3_BAX-01       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6MIN3_BAX-03       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6M2P5_BOK-01       gtgtggt------------------------------------cagcaca
A0A2K6MNN9_BAK1-02      gggtggctgggtgg-----------------------------cagccct
A0A2K6MNN9_BAK1-01      gggtggctgggtgg-----------------------------cagccct
A0A2K6MNN9_BAK1-03      --------------------------------------------------

A0A2K6MIN3_BAX-04       gcccctgccccactgtccc------------ttggtg-------------
A0A2K6MIN3_BAX-02       gaccgtgacc------atc------------ttggtggctggagtactca
A0A2K6MIN3_BAX-01       gaccgtgacc------atc------------ttggtggctggagtactca
A0A2K6MIN3_BAX-03       gaccgtgacc------atc------------ttggtggctggagtactca
A0A2K6M2P5_BOK-01       gaccctggcctccgctccc-------actggctggtagct----gcactg
A0A2K6MNN9_BAK1-02      gaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtgg
A0A2K6MNN9_BAK1-01      gaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtgg
A0A2K6MNN9_BAK1-03      --------------------------------------------------

A0A2K6MIN3_BAX-04       ----ccctctccccatctttggatcatcagatgtggtctataatgcattt
A0A2K6MIN3_BAX-02       ccgcctccctcaccatc--tgga--agaagatggg---------------
A0A2K6MIN3_BAX-01       ccgcctccctcaccatc--tgga--agaagatggg---------------
A0A2K6MIN3_BAX-03       ccgcctccctcaccatc--tgga--agaagatggg---------------
A0A2K6M2P5_BOK-01       tgcagcttcggccgcttcctgaa-----ggctgccttcttcgtgctgctg
A0A2K6MNN9_BAK1-02      ttctg-ttgggccagtttgtggt-----acgaagattcttc---------
A0A2K6MNN9_BAK1-01      ttctg-ttgggccagtttgtggt-----acgaagattcttc---------
A0A2K6MNN9_BAK1-03      --------------------------------------------------

A0A2K6MIN3_BAX-04       ccttacgtgtct
A0A2K6MIN3_BAX-02       -ctga-------
A0A2K6MIN3_BAX-01       -ctga-------
A0A2K6MIN3_BAX-03       -ctga-------
A0A2K6M2P5_BOK-01       ccagagagatga
A0A2K6MNN9_BAK1-02      ---aaatcatga
A0A2K6MNN9_BAK1-01      ---aaatcatga
A0A2K6MNN9_BAK1-03      ------------

© 1998-2019