Dataset for CDS BAX of Organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6MIN3_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6MIN3_BAX-02      atggacgggtccggggagcagcccagaggcgggggagcgac--accccgt
A0A2K6MIN3_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6MIN3_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ***********************************  * **   * * * 

A0A2K6MIN3_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K6MIN3_BAX-02      tctgattct----------gcaccctcactccatc------------ccc
A0A2K6MIN3_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2K6MIN3_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                        * ***  *          ** *  *  ** **                 

A0A2K6MIN3_BAX-04      gagcagggcgaatggggggggagacacccgagctggccctggacccagtg
A0A2K6MIN3_BAX-02      actctaggcgaatggggggggagacacccgagctggccctggacccagtg
A0A2K6MIN3_BAX-03      --------------------------------------------------
A0A2K6MIN3_BAX-01      gagcagggcgaatggggggggagacacccgagctggccctggacccagtg

A0A2K6MIN3_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K6MIN3_BAX-02      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K6MIN3_BAX-03      --------------------------------------------------
A0A2K6MIN3_BAX-01      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg

A0A2K6MIN3_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K6MIN3_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K6MIN3_BAX-03      --------------------------------ggatgattgccgccgtgg
A0A2K6MIN3_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg

A0A2K6MIN3_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6MIN3_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6MIN3_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K6MIN3_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt

A0A2K6MIN3_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6MIN3_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6MIN3_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K6MIN3_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc

A0A2K6MIN3_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6MIN3_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6MIN3_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K6MIN3_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca

A0A2K6MIN3_BAX-04      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K6MIN3_BAX-02      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K6MIN3_BAX-03      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K6MIN3_BAX-01      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc

A0A2K6MIN3_BAX-04      tggatccaagaccagggtggttgggtgagactcctcaaccctcct-----
A0A2K6MIN3_BAX-02      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
A0A2K6MIN3_BAX-03      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
A0A2K6MIN3_BAX-01      tggatccaagaccagggtggttgggacggcctcctc--tcctactttggg
                       *************************   * ******   *** **     

A0A2K6MIN3_BAX-04      -caccccaaccaccgcccctgccccactgtcccttggtg-----------
A0A2K6MIN3_BAX-02      acgcccacgtggcagaccgtgacc------atcttggtggctggagtact
A0A2K6MIN3_BAX-03      acgcccacgtggcagaccgtgacc------atcttggtggctggagtact
A0A2K6MIN3_BAX-01      acgcccacgtggcagaccgtgacc------atcttggtggctggagtact
                        * ***      * * ** ** **        *******           

A0A2K6MIN3_BAX-04      ------ccctctccccatctttggatcatcagatgtggtctataatgcat
A0A2K6MIN3_BAX-02      caccgcctccctcaccatc--tgga--agaagatggg-------------
A0A2K6MIN3_BAX-03      caccgcctccctcaccatc--tgga--agaagatggg-------------
A0A2K6MIN3_BAX-01      caccgcctccctcaccatc--tgga--agaagatggg-------------
                             * * *** *****  ****  *  ***** *             

A0A2K6MIN3_BAX-04      ttccttacgtgtct
A0A2K6MIN3_BAX-02      ---ctga-------
A0A2K6MIN3_BAX-03      ---ctga-------
A0A2K6MIN3_BAX-01      ---ctga-------
                          ** *       

© 1998-2019