Dataset for CDS BAK1 of Organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6MNN9_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K6MNN9_BAK1-03      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K6MNN9_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                        **************************************************

A0A2K6MNN9_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K6MNN9_BAK1-03      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K6MNN9_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                        **************************************************

A0A2K6MNN9_BAK1-02      ttttccgcagctacgttttttaccgccatcagcagaacc-----------
A0A2K6MNN9_BAK1-03      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K6MNN9_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                        *********************************** * *           

A0A2K6MNN9_BAK1-02      ----------cctctgccatgagcca------------------------
A0A2K6MNN9_BAK1-03      ggggcggctgcccctgcc--gacccagagatggtcaccttgcccctgcaa
A0A2K6MNN9_BAK1-01      ggggcggctgcccctgcc--gacccagagatggtcaccttgcccctgcaa
                                  ** *****  ** ***                        

A0A2K6MNN9_BAK1-02      --------------aggcctggtgggacggcagctcgccatcatcgggga
A0A2K6MNN9_BAK1-03      cctagcagcaccatgggacaggtgggacggcagctcgccatcatcgggga
A0A2K6MNN9_BAK1-01      cctagcagcaccatgggacaggtgggacggcagctcgccatcatcgggga
                                       ** * ******************************

A0A2K6MNN9_BAK1-02      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc
A0A2K6MNN9_BAK1-03      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc
A0A2K6MNN9_BAK1-01      cgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacc
                        **************************************************

A0A2K6MNN9_BAK1-02      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctc-
A0A2K6MNN9_BAK1-03      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctcc
A0A2K6MNN9_BAK1-01      tgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctc-
                        ************************************************* 

A0A2K6MNN9_BAK1-02      -------------------cagcctgtttgagagtggcatcaactggggc
A0A2K6MNN9_BAK1-03      aggccagcaacaacacccacagcctgtttgagagtggcatcaactggggc
A0A2K6MNN9_BAK1-01      -------------------cagcctgtttgagagtggcatcaactggggc
                                           *******************************

A0A2K6MNN9_BAK1-02      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta
A0A2K6MNN9_BAK1-03      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta
A0A2K6MNN9_BAK1-01      cgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtcta
                        **************************************************

A0A2K6MNN9_BAK1-02      ccagcgtggcctgactggcttcctgggccaggtgacccgcttcgtggtcg
A0A2K6MNN9_BAK1-03      ccagcgtggcctga------------------------------------
A0A2K6MNN9_BAK1-01      ccagcgtggcctgactggcttcctgggccaggtgacccgcttcgtggtcg
                        **************                                    

A0A2K6MNN9_BAK1-02      atttcatgctgcatcactgcattgcccggtggattgcacagaggggtggc
A0A2K6MNN9_BAK1-03      --------------------------------------------------
A0A2K6MNN9_BAK1-01      atttcatgctgcatcactgcattgcccggtggattgcacagaggggtggc
                                                                          

A0A2K6MNN9_BAK1-02      tgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggt
A0A2K6MNN9_BAK1-03      --------------------------------------------------
A0A2K6MNN9_BAK1-01      tgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggt
                                                                          

A0A2K6MNN9_BAK1-02      ggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttca
A0A2K6MNN9_BAK1-03      --------------------------------------------------
A0A2K6MNN9_BAK1-01      ggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttca
                                                                          

A0A2K6MNN9_BAK1-02      aatcatga
A0A2K6MNN9_BAK1-03      --------
A0A2K6MNN9_BAK1-01      aatcatga
                                

© 1998-2018