Dataset for CDS BOK of Organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G0YKA8_BOK-01      atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgc
Q792S6_BOK-02      atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgc
Q792S6_BOK-01      atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgc
                   ************************************************************

G0YKA8_BOK-01      tcgcccacagacaaggagctggtggcccaggctaaagcactaggccgggagtacgtgcac
Q792S6_BOK-02      tcgcccacagacaaggagctggtggcccaggctaaagcactaggccgggagtacgtgcac
Q792S6_BOK-01      tcgcccacagacaaggagctggtggcccaggctaaagcactaggccgggagtacgtgcac
                   ************************************************************

G0YKA8_BOK-01      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
Q792S6_BOK-02      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
Q792S6_BOK-01      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
                   ************************************************************

G0YKA8_BOK-01      ggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
Q792S6_BOK-02      ggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttg------------------
Q792S6_BOK-01      ggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
                   ******************************************                  

G0YKA8_BOK-01      atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgag
Q792S6_BOK-02      ------------------------------------------------------------
Q792S6_BOK-01      atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgag
                                                                               

G0YKA8_BOK-01      cctgtggtgactgatgccttcctcgctgtggccggccacatcttctcagcagg-------
Q792S6_BOK-02      ---------------------------------------------------ggtatcaca
Q792S6_BOK-01      cctgtggtgactgatgccttcctcgctgtggccggccacatcttctcagcaggtatcaca
                                                                      **       

G0YKA8_BOK-01      ------------------------------------------------------------
Q792S6_BOK-02      tggggcaaggtagtgtccctgtactcggtggctgcgggactagcggtggactgcgtccgg
Q792S6_BOK-01      tggggcaaggtagtgtccctgtactcggtggctgcgggactagcggtggactgcgtccgg
                                                                               

G0YKA8_BOK-01      ---------------------------------------------------------aag
Q792S6_BOK-02      caagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
Q792S6_BOK-01      caagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
                                                                            ***

G0YKA8_BOK-01      acattga-----------------------------------------------------
Q792S6_BOK-02      accctggccacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtc
Q792S6_BOK-01      accctggccacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtc
                   **  **                                                      

G0YKA8_BOK-01      ------------------------------------------------------------
Q792S6_BOK-02      agcacagaccctggcttccgctcccactggctcgtggccacactctgcagctttggccgc
Q792S6_BOK-01      agcacagaccctggcttccgctcccactggctcgtggccacactctgcagctttggccgc
                                                                               

G0YKA8_BOK-01      ------------------------------------------
Q792S6_BOK-02      ttcctgaaggctgcattcttcctcctgttgccagagagatga
Q792S6_BOK-01      ttcctgaaggctgcattcttcctcctgttgccagagagatga
                                                             

© 1998-2018