Dataset for CDS BAX-like of Organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q63690_BAX-01       ------------------------------------------------------------
Q9JKL3_BAX-01       atggacgggtccggggatcatctcggaggcggcgggcccaccagctctgaacagatcatg
Q9JKL3_BAX-02       ---------------------------------------------------------atg
Q9JK59_BAK1-01      atggcatccggacaaggaccaggtcctcccaagggggactgcgat---------------
G0YKA8_BOK-01       atgg----------------aggtgctgc---ggcgctcttcggtcttcgct-----gcg
Q792S6_BOK-01       atgg----------------aggtgctgc---ggcgctcttcggtcttcgct-----gcg
Q792S6_BOK-02       atgg----------------aggtgctgc---ggcgctcttcggtcttcgct-----gcg

Q63690_BAX-01       ----------------------------------------------agaggatggctg--
Q9JKL3_BAX-01       aagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctg--
Q9JKL3_BAX-02       aagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctg--
Q9JK59_BAK1-01      gaggccctgtctgcttctgaacagcaagttgccca-ggacaca--gaggaggtctttcga
G0YKA8_BOK-01       gagatcatggacgcctttgatc----gctcgcccacagacaag--gagctggtggccc-a
Q792S6_BOK-01       gagatcatggacgcctttgatc----gctcgcccacagacaag--gagctggtggccc-a
Q792S6_BOK-02       gagatcatggacgcctttgatc----gctcgcccacagacaag--gagctggtggccc-a
                                                                  **  * *       

Q63690_BAX-01       --------------------------gggagacacctgagc---tgaccttggagcagcc
Q9JKL3_BAX-01       --------------------------gggagacacctgagc---tgaccttggagcagcc
Q9JKL3_BAX-02       --------------------------gggagacacctgagc---tgaccttggagcagcc
Q9JK59_BAK1-01      agctacgttttttacctccaccag--caggaacaagagacccagggg-------gcagcc
G0YKA8_BOK-01       ggctaaag----------cactaggccgggagtacgtgcacgcgcggcttttgcgcgccg
Q792S6_BOK-01       ggctaaag----------cactaggccgggagtacgtgcacgcgcggcttttgcgcgccg
Q792S6_BOK-02       ggctaaag----------cactaggccgggagtacgtgcacgcgcggcttttgcgcgccg
                                                *    *   *  *    *        **  * 

Q63690_BAX-01       gc--------------cccagga-------cgcatccaccaagaagctgagcgag---tg
Q9JKL3_BAX-01       gc--------------cccagga-------cgcatccaccaagaagctgagcgag---tg
Q9JKL3_BAX-02       gc--------------cccagga-------cgcatccaccaagaagctgagcgag---tg
Q9JK59_BAK1-01      gcccctgctaa-----ccctgag-atggacaacttgtccctagaacccaacagtgtcttg
G0YKA8_BOK-01       gcctctcctggagcgctccagagcgtgcctcgcctgcccctggaggacg-------cctg
Q792S6_BOK-01       gcctctcctggagcgctccagagcgtgcctcgcctgcccctggaggacg-------cctg
Q792S6_BOK-02       gcctctcctggagcgctccagagcgtgcctcgcctgcccctggaggacg-------cctg
                    **               ** *           * *   **  **              **

Q63690_BAX-01       tctcaggcgaattggcgatgaact---------------------------ggacaacaa
Q9JKL3_BAX-01       tctcaggcgaattggcgatgaact---------------------------ggacaacaa
Q9JKL3_BAX-02       tctcaggcgaattggcgatgaact---------------------------ggacaacaa
Q9JK59_BAK1-01      ggtcaggtgggtcggcagcttgct----ctcatcggagacgatattaatcggcgctacga
G0YKA8_BOK-01       gcagaggtg----tgcaccgtgctgctgcgcttgggagatgagctggagcagatccgtcc
Q792S6_BOK-01       gcagaggtg----tgcaccgtgctgctgcgcttgggagatgagctggagcagatccgtcc
Q792S6_BOK-02       gcagaggtg----tgcaccgtgctgctgcgcttg--------------------------
                        *** *     **      **                                    

Q63690_BAX-01       catggagctgcagaggatgattgctgatgtggatacagactccc------------cccg
Q9JKL3_BAX-01       catggagctgcagaggatgattgctgatgtggatacagactccc------------cccg
Q9JKL3_BAX-02       catggagctgcagaggatgattgctgatgtggatacagactccc------------cccg
Q9JK59_BAK1-01      cacggagttccagaat----ttactggaacagcttcagcccacc------------gctg
G0YKA8_BOK-01       cagcgtatatcggaat----gtggcccggcagctgcacatccccctgcagtctgagcctg
Q792S6_BOK-01       cagcgtatatcggaat----gtggcccggcagctgcacatccccctgcagtctgagcctg
Q792S6_BOK-02       ------------------------------------------------------------

Q63690_BAX-01       agag-------gtcttcttccgtgtggcagctgacatgtttgcagacggc-aacttcaac
Q9JKL3_BAX-01       agag-------gtcttcttccgtgtggcagctgacatgtttgcagacggc-aacttcaac
Q9JKL3_BAX-02       agag-------gtcttcttccgtgtggcagctgacatgtttgcagacggc-aacttcaac
Q9JK59_BAK1-01      ggaatgcctacgaactcttcaccaagatcgcctccagcctatttaagagc-ggcatcagc
G0YKA8_BOK-01       tggtgactgatgccttcctcgctgtggccggccacatcttctc----agcagg-------
Q792S6_BOK-01       tggtgactgatgccttcctcgctgtggccggccacatcttctc----agcaggtatcaca
Q792S6_BOK-02       ---------------------------------------------------ggtatcaca

Q63690_BAX-01       tggggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtgc
Q9JKL3_BAX-01       tggggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtgc
Q9JKL3_BAX-02       tggggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtgc
Q9JK59_BAK1-01      tggggccgtgtggtggctctcctgggctttggctaccgtctggccctgtatgtctaccag
G0YKA8_BOK-01       ------------------------------------------------------------
Q792S6_BOK-01       tggggcaaggtagtgtcc--------------ctgtactcggtggctgcgggactagcgg
Q792S6_BOK-02       tggggcaaggtagtgtcc--------------ctgtactcggtggctgcgggactagcgg

Q63690_BAX-01       actaaagtgcccgagctgatcagaaccatcatgggctggacactgg--------------
Q9JKL3_BAX-01       actaaagtgcccgagctgatcagaaccatcatgggctggacactgg--------------
Q9JKL3_BAX-02       actaaagtgcccgagctgatcagaaccatcatgggctggacactgg--------------
Q9JK59_BAK1-01      cgtggtttgactg-gcttcctgggccag--gtgacctgctttttggctgatatcata---
G0YKA8_BOK-01       ------------------------------------------------------------
Q792S6_BOK-01       tggactgcgtccg-gcaagctcagccagccatggttcatgccctggttgactgcctgggg
Q792S6_BOK-02       tggactgcgtccg-gcaagctcagccagccatggttcatgccctggttgactgcctgggg

Q63690_BAX-01       -acttcctccgggagcggctgtttgtctggatccaagaccagggtggctgggatggcctc
Q9JKL3_BAX-01       -acttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggcctc
Q9JKL3_BAX-02       -acttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggcctc
Q9JK59_BAK1-01      ------ctacaccattacattgccagatggattgcacagagaggtggttgggtggcagcc
G0YKA8_BOK-01       ------------aagacattga--------------------------------------
Q792S6_BOK-01       gaatttgtacgcaagaccctggccacctggcttcggaggcgtggtggatggacggacgtc
Q792S6_BOK-02       gaatttgtacgcaagaccctggccacctggcttcggaggcgtggtggatggacggacgtc
                                 *     *                                        

Q63690_BAX-01       ct---------------ttcctacttcgggacgcccacat--------------------
Q9JKL3_BAX-01       ct---------------ttcctacttcgggacccccacatggcagacagtgaccatcttt
Q9JKL3_BAX-02       ct---------------ttcctacttcgggacccccacatggcagacagtgaccatcttt
Q9JK59_BAK1-01      ct-gagtttgcgtagagaccccatcctgagtgtag----tggtaatttttggtgtggttc
G0YKA8_BOK-01       ------------------------------------------------------------
Q792S6_BOK-01       ctcaagtgtgtggtcagcacagaccctggcttccgctcccactggctcgtggccacactc
Q792S6_BOK-02       ctcaagtgtgtggtcagcacagaccctggcttccgctcccactggctcgtggccacactc

Q63690_BAX-01       ---------------------------------------------------------
Q9JKL3_BAX-01       ------gtggctggagtcctcactgcctcactcaccatctggaagaagatgggctga
Q9JKL3_BAX-02       ------gtggctggagtcctcactgcctcactcaccatctggaagaagatgggctga
Q9JK59_BAK1-01      tg----ttgggccaatttgtggtacacagattcttc------------agatcatga
G0YKA8_BOK-01       ---------------------------------------------------------
Q792S6_BOK-01       tgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagatga
Q792S6_BOK-02       tgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagatga

© 1998-2019