Dataset for CDS BAX of Organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q63690_BAX-01      ------------------------------------------------------------
Q9JKL3_BAX-01      atggacgggtccggggatcatctcggaggcggcgggcccaccagctctgaacagatcatg
Q9JKL3_BAX-02      ---------------------------------------------------------atg
                                                                               

Q63690_BAX-01      ----------------------------------------------agaggatggctggg
Q9JKL3_BAX-01      aagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctggg
Q9JKL3_BAX-02      aagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctggg
                                                                 **************

Q63690_BAX-01      gagacacctgagctgaccttggagcagccgccccaggacgcatccaccaagaagctgagc
Q9JKL3_BAX-01      gagacacctgagctgaccttggagcagccgccccaggacgcatccaccaagaagctgagc
Q9JKL3_BAX-02      gagacacctgagctgaccttggagcagccgccccaggacgcatccaccaagaagctgagc
                   ************************************************************

Q63690_BAX-01      gagtgtctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgatt
Q9JKL3_BAX-01      gagtgtctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgatt
Q9JKL3_BAX-02      gagtgtctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgatt
                   ************************************************************

Q63690_BAX-01      gctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatgttt
Q9JKL3_BAX-01      gctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatgttt
Q9JKL3_BAX-02      gctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatgttt
                   ************************************************************

Q63690_BAX-01      gcagacggcaacttcaactggggccgggtggttgcccttttctactttgctagcaaactg
Q9JKL3_BAX-01      gcagacggcaacttcaactggggccgggtggttgcccttttctactttgctagcaaactg
Q9JKL3_BAX-02      gcagacggcaacttcaactggggccgggtggttgcccttttctactttgctagcaaactg
                   ************************************************************

Q63690_BAX-01      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca
Q9JKL3_BAX-01      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca
Q9JKL3_BAX-02      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca
                   ************************************************************

Q63690_BAX-01      ctggacttcctccgggagcggctgtttgtctggatccaagaccagggtggctgggatggc
Q9JKL3_BAX-01      ctggacttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggc
Q9JKL3_BAX-02      ctggacttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggc
                   ************************ ***********************************

Q63690_BAX-01      ctcctttcctacttcgggacgcccacat--------------------------------
Q9JKL3_BAX-01      ctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtc
Q9JKL3_BAX-02      ctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtc
                   ******************** *******                                

Q63690_BAX-01      ---------------------------------------
Q9JKL3_BAX-01      ctcactgcctcactcaccatctggaagaagatgggctga
Q9JKL3_BAX-02      ctcactgcctcactcaccatctggaagaagatgggctga
                                                          

© 1998-2018