Dataset for CDS BAX-like of Organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6FZV4_BAX-04       atggacgggtccggggagcagcccag-------aggcggggg--------
A0A2K6FZV4_BAX-02       atggacgggtccggggagcagcccag-------aggcggggg--------
A0A2K6FZV4_BAX-01       atggacgggtccggggagcagcccag-------aggcggggg--------
A0A2K6FZV4_BAX-03       atggacgggtccggggagcagcccag-------aggcggggg--------
A0A2K6ES66_BOK-01       atgg-aggtgctgcggcgctcctcggtcctcgccgccgagatcatggacg
A0A2K6FT73_BAK1-01      atgg-ca--tctgggcaaggcccaggtcctcccgggcaggggtgcggaga
                        ****      * * *      *   *        * *  *          

A0A2K6FZV4_BAX-04       -------------gcccaccagctctgagcagatcatgaagac-------
A0A2K6FZV4_BAX-02       -------------------------------------tgaggc-------
A0A2K6FZV4_BAX-01       -------------gcccaccagctctgagcagatcatgaagac-------
A0A2K6FZV4_BAX-03       -------------gcccaccagctctgagcagatcatgaagac-------
A0A2K6ES66_BOK-01       cctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcg
A0A2K6FT73_BAK1-01      gcctgccccgc-ctcccacttctgaggagcaggtagcccgggacacag--

A0A2K6FZV4_BAX-04       ------aggggcccttt-----tgcttcagggtttcatccaggatcgagc
A0A2K6FZV4_BAX-02       ------gggagc--------------------------------------
A0A2K6FZV4_BAX-01       ------aggggcccttt-----tgcttcagggtttcatccaggatcgagc
A0A2K6FZV4_BAX-03       ------aggggcccttt-----tgcttcagg-------------------
A0A2K6ES66_BOK-01       ctgggcagggagttcgtgcacgcgcggct--gctgcgcgccggcctcgcc
A0A2K6FT73_BAK1-01      ------aggaggttttc-----cgcagctacgttttttaccgccatcagc

A0A2K6FZV4_BAX-04       agg-----gcgaatggggggggaagcacccgagctgggtctggagccgac
A0A2K6FZV4_BAX-02       agg-----gcgaatggggggggaagcacccgagctgggtctggagccgac
A0A2K6FZV4_BAX-01       agg-----gcgaatggggggggaagcacccgagctgggtctggagccgac
A0A2K6FZV4_BAX-03       --------------------------------------------------
A0A2K6ES66_BOK-01       tggagc--gtgcccgagcgcg-------ccgcgctcgtcccggga-ggcc
A0A2K6FT73_BAK1-01      aggagcaggaggccgagggggcagctgccctcgctgacccagagatggac

A0A2K6FZV4_BAX-04       gcc--------------------ccaggatgcatccaccaagaagctgag
A0A2K6FZV4_BAX-02       gcc--------------------ccaggatgcatccaccaagaagctgag
A0A2K6FZV4_BAX-01       gcc--------------------ccaggatgcatccaccaagaagctgag
A0A2K6FZV4_BAX-03       --------------------------------------------------
A0A2K6ES66_BOK-01       gcctggcggaggtgtccgcggtgct--gctgcg-cc-tgggggatg----
A0A2K6FT73_BAK1-01      acct--------tgcccctagagcctagcagca-ccatggggcaggtggg

A0A2K6FZV4_BAX-04       cgagtgtctcaagcgcatcggggatgaactggaca-gtaacatggagctg
A0A2K6FZV4_BAX-02       cgagtgtctcaagcgcatcggggatgaactggaca-gtaacatggagctg
A0A2K6FZV4_BAX-01       cgagtgtctcaagcgcatcggggatgaactggaca-gtaacatggagctg
A0A2K6FZV4_BAX-03       --------------------------------------------------
A0A2K6ES66_BOK-01       -----agctggagctgatccggcccagcgtgtacc-gcaacgtggcgcgg
A0A2K6FT73_BAK1-01      tcgacagctcgccatcatcggggacgacatcaaccggcgctatgacgcgg

A0A2K6FZV4_BAX-04       cagagaatgat--tgctgctgtggacacagactccccccgtgaggtcttt
A0A2K6FZV4_BAX-02       cagagaatgat--tgctgctgtggacacagactccccccgtgaggtcttt
A0A2K6FZV4_BAX-01       cagagaatgat--tgctgctgtggacacagactccccccgtgaggtcttt
A0A2K6FZV4_BAX-03       ----gaatgat--tgctgctgtggacacagactccccccgtgaggtcttt
A0A2K6ES66_BOK-01       cagctgcacatctccctgcagtcc---gag---cccgtggtgactgatgc
A0A2K6FT73_BAK1-01      -agttccagaccatgctgcagcacctgcag---cccacagcagagaatgc
                                 *     **** *       **   ***   *       *  

A0A2K6FZV4_BAX-04       ttccga----------------gtggcagctgacatgttttctgacggca
A0A2K6FZV4_BAX-02       ttccga----------------gtggcagctgacatgttttctgacggca
A0A2K6FZV4_BAX-01       ttccga----------------gtggcagctgacatgttttctgacggca
A0A2K6FZV4_BAX-03       ttccga----------------gtggcagctgacatgttttctgacggca
A0A2K6ES66_BOK-01       gt------------tcctggccgtggcaggccacatcttctctgcaggca
A0A2K6FT73_BAK1-01      ctacgagtatttcatcaagatcgccacgagcc---tgtttgagagtggca
                         *                    *   *        * **       ****

A0A2K6FZV4_BAX-04       acttcaactggggccgggttgtcgcccttttctacttcgccagcaaactg
A0A2K6FZV4_BAX-02       acttcaactggggccgggttgtcgcccttttctacttcgccagcaaactg
A0A2K6FZV4_BAX-01       acttcaactggggccgggttgtcgcccttttctacttcgccagcaaactg
A0A2K6FZV4_BAX-03       acttcaactggggccgggttgtcgcccttttctacttcgccagcaaactg
A0A2K6ES66_BOK-01       ---tcacgtggggcaaggtggtg----tccctgtacgcggtggccgc--a
A0A2K6FT73_BAK1-01      ---taaactggggtcgtgtggtggctctcctgggcttcggctaccgcctg
                           * *  *****    ** **     *         **    *      

A0A2K6FZV4_BAX-04       gtgctcaaggccctgtgcacca-aggtgcccgagctgatcagaaccatta
A0A2K6FZV4_BAX-02       gtgctcaaggccctgtgcacca-aggtgcccgagctgatcagaaccatta
A0A2K6FZV4_BAX-01       gtgctcaaggccctgtgcacca-aggtgcccgagctgatcagaaccatta
A0A2K6FZV4_BAX-03       gtgctcaaggccctgtgcacca-aggtgcccgagctgatcagaaccatta
A0A2K6ES66_BOK-01       gcgct-----ggccgtggactgcgtgcggcaggcccagccag-----cca
A0A2K6FT73_BAK1-01      gctct-----gcacgtttacca-gcgcggcctgactggct-------tcc
                        *  **         **  **     * * *    *               

A0A2K6FZV4_BAX-04       tgggctgga---cgatggacttcctccgagagcggctgctgggc------
A0A2K6FZV4_BAX-02       tgggctgga---cgatggacttcctccgagagcggctgctgggc------
A0A2K6FZV4_BAX-01       tgggctgga---cgatggacttcctccgagagcggctgctgggc------
A0A2K6FZV4_BAX-03       tgggctgga---cgatggacttcctccgagagcggctgctgggc------
A0A2K6ES66_BOK-01       tggtccacgccctcgtcgactgcttgggagagtttgtgc-gcaagaccct
A0A2K6FT73_BAK1-01      tgggccagg---tgacccgcttcgtggccgacttcatgctgcatcactac
                        *** *              ** * *    **     *** *         

A0A2K6FZV4_BAX-04       ---------tggatccaagaccagggtggttgggtgagaccccgcaaccc
A0A2K6FZV4_BAX-02       ---------tggatccaagaccagggtggttgggacggccttctc-----
A0A2K6FZV4_BAX-01       ---------tggatccaagaccagggtggttgggacggccttctc-----
A0A2K6FZV4_BAX-03       ---------tggatccaagaccagggtggttgggacggccttctc-----
A0A2K6ES66_BOK-01       ggcgacc--tggct---gcggaggcgcgg-tggatggactgacgtcctca
A0A2K6FT73_BAK1-01      atcgcccggtggatcgcacagaggggcggctgggtgg-------------
                                 *** *         * * ** ***                 

A0A2K6FZV4_BAX-04       agccccaccccacctgggaccc-------------cac------------
A0A2K6FZV4_BAX-02       -------tcctactttggaaccccgacgtggcaaacag------------
A0A2K6FZV4_BAX-01       -------tcctactttggaaccccgacgtggcaaacag------------
A0A2K6FZV4_BAX-03       -------tcctactttggaaccccgacgtggcaaacag------------
A0A2K6ES66_BOK-01       agtgcgtggtcagcacggagcctggcctccgctcccac----------tg
A0A2K6FT73_BAK1-01      ----------cagccctggacttgggcaatggccccatccggaatgtgct
                                   *     *  *              **             

A0A2K6FZV4_BAX-04       --tgggccttcccgcac--cagaggtgccctctccccattttcag-----
A0A2K6FZV4_BAX-02       --tgaccatctttgtgg--ccggagtgctcaccgcc------tcg-----
A0A2K6FZV4_BAX-01       --tgaccatctttgtgg--ccggagtgctcaccgcc------tcg-----
A0A2K6FZV4_BAX-03       --tgaccatctttgtgg--ccggagtgctcaccgcc------tcg-----
A0A2K6ES66_BOK-01       gctgg---tggctgc-gctctgcggcgcctgccgct------tcctgagg
A0A2K6FT73_BAK1-01      gctggttctggccgtggttctgttgggccag----t------tcgtggta
                          **    *    *     * *  * **                      

A0A2K6FZV4_BAX-04       ------atcatcagctgtagtctgtaatgtttccttacttgtccca
A0A2K6FZV4_BAX-02       ------ctcaccatctggaagaag--atg-----------ggctga
A0A2K6FZV4_BAX-01       ------ctcaccatctggaagaag--atg-----------ggctga
A0A2K6FZV4_BAX-03       ------ctcaccatctggaagaag--atg-----------ggctga
A0A2K6ES66_BOK-01       gctgccttcttcatgctgctgccagaaag-------------atga
A0A2K6FT73_BAK1-01      cgaagattcttca------------actc-------------atga
                               **  **                                *

© 1998-2019