Dataset for CDS BAX of Organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6FZV4_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6FZV4_BAX-02      atggacgggtccggggagcagcccagaggcggggg---------------
A0A2K6FZV4_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K6FZV4_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga

A0A2K6FZV4_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K6FZV4_BAX-02      ---------tgaggcgggagc-----------------------------
A0A2K6FZV4_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2K6FZV4_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                                  ** * ** **                             

A0A2K6FZV4_BAX-04      gagcagggcgaatggggggggaagcacccgagctgggtctggagccgacg
A0A2K6FZV4_BAX-02      ----agggcgaatggggggggaagcacccgagctgggtctggagccgacg
A0A2K6FZV4_BAX-03      --------------------------------------------------
A0A2K6FZV4_BAX-01      gagcagggcgaatggggggggaagcacccgagctgggtctggagccgacg

A0A2K6FZV4_BAX-04      ccccaggatgcatccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K6FZV4_BAX-02      ccccaggatgcatccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K6FZV4_BAX-03      --------------------------------------------------
A0A2K6FZV4_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctcaagcgcatcgg

A0A2K6FZV4_BAX-04      ggatgaactggacagtaacatggagctgcagagaatgattgctgctgtgg
A0A2K6FZV4_BAX-02      ggatgaactggacagtaacatggagctgcagagaatgattgctgctgtgg
A0A2K6FZV4_BAX-03      --------------------------------gaatgattgctgctgtgg
A0A2K6FZV4_BAX-01      ggatgaactggacagtaacatggagctgcagagaatgattgctgctgtgg

A0A2K6FZV4_BAX-04      acacagactccccccgtgaggtctttttccgagtggcagctgacatgttt
A0A2K6FZV4_BAX-02      acacagactccccccgtgaggtctttttccgagtggcagctgacatgttt
A0A2K6FZV4_BAX-03      acacagactccccccgtgaggtctttttccgagtggcagctgacatgttt
A0A2K6FZV4_BAX-01      acacagactccccccgtgaggtctttttccgagtggcagctgacatgttt

A0A2K6FZV4_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctacttcgc
A0A2K6FZV4_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctacttcgc
A0A2K6FZV4_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctacttcgc
A0A2K6FZV4_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctacttcgc

A0A2K6FZV4_BAX-04      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
A0A2K6FZV4_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
A0A2K6FZV4_BAX-03      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
A0A2K6FZV4_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca

A0A2K6FZV4_BAX-04      gaaccattatgggctggacgatggacttcctccgagagcggctgctgggc
A0A2K6FZV4_BAX-02      gaaccattatgggctggacgatggacttcctccgagagcggctgctgggc
A0A2K6FZV4_BAX-03      gaaccattatgggctggacgatggacttcctccgagagcggctgctgggc
A0A2K6FZV4_BAX-01      gaaccattatgggctggacgatggacttcctccgagagcggctgctgggc

A0A2K6FZV4_BAX-04      tggatccaagaccagggtggttgggtgagaccccgcaacccagccccacc
A0A2K6FZV4_BAX-02      tggatccaagaccagggtggttgggacggccttctc------------tc
A0A2K6FZV4_BAX-03      tggatccaagaccagggtggttgggacggccttctc------------tc
A0A2K6FZV4_BAX-01      tggatccaagaccagggtggttgggacggccttctc------------tc
                       *************************   * *  * *             *

A0A2K6FZV4_BAX-04      ccacctgggaccc-------------cactgggccttcccgcaccagagg
A0A2K6FZV4_BAX-02      ctactttggaaccccgacgtggcaaacagtgaccatctttgtggccggag
A0A2K6FZV4_BAX-03      ctactttggaaccccgacgtggcaaacagtgaccatctttgtggccggag
A0A2K6FZV4_BAX-01      ctactttggaaccccgacgtggcaaacagtgaccatctttgtggccggag
                       * ** * *** **             ** **  * *    *   * *  *

A0A2K6FZV4_BAX-04      tgccctctccccattttcagatcatcagctgtagtctgtaatgtttcctt
A0A2K6FZV4_BAX-02      tgctcaccgcc------tcgctcaccatctggaagaag--atg-------
A0A2K6FZV4_BAX-03      tgctcaccgcc------tcgctcaccatctggaagaag--atg-------
A0A2K6FZV4_BAX-01      tgctcaccgcc------tcgctcaccatctggaagaag--atg-------
                       *** * *  **        * *** ** *** *    *  ***       

A0A2K6FZV4_BAX-04      acttgtccca
A0A2K6FZV4_BAX-02      ----ggctga
A0A2K6FZV4_BAX-03      ----ggctga
A0A2K6FZV4_BAX-01      ----ggctga
                           * *  *

© 1998-2019