Dataset for CDS BAX-like of Organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NZJ1_BAX-01       atg---gcgccacggctggcacttatctggagatgctcattggacagtcacgtgacggga
H2P970_BOK-01       atggaggtgctgcgg--cgc---tcctcgg----tcttcgccgccgagatcatggacgcc
H2PIQ6_BAK1-01      atg-----gcttcgg--ggcaaggcccagg----tcctcccaggcaggagtgcggagagc
                    ***     **  ***   **        **     *      * *        *      

H2NZJ1_BAX-01       ccaagcctcccg---------agggagcgaggcaggtgcggtcacgtgacccagcggcgc
H2P970_BOK-01       tttgaccgctcgcccacagacaaggagc-tggtggcccaggccaaggcgctgggccggga
H2PIQ6_BAK1-01      ctgccctgccc-tctgcttctgaggagc-aggtagcccgggacac------------aga
                         *  * *            *****  **  *    ** **              * 

H2NZJ1_BAX-01       tgcggggc---agcggccattttgcggggcggccacgtgagggacgcacgttcag-----
H2P970_BOK-01       gtacgtgcacgcgcggctac--tgcgcgccggcctctcctggagcgcgcccgagcgcgcc
H2PIQ6_BAK1-01      ggaggttttc-cgcagctacgttttttaccgccatcagcaggaa----------------
                        *       ** ** *   *      ** *  *    **                  

H2NZJ1_BAX-01       ----------cggggctctcacgtgacccgggcgcgctgcggccgcccgcg---------
H2P970_BOK-01       gcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggggatgag
H2PIQ6_BAK1-01      ----------cagga-----ggctgaa--------ggggcggctgcccctg---------
                              * **         ***         *  ** ** ** *  *         

H2NZJ1_BAX-01       -----------cggacccggcgagaggcggcggcgggagcggcggtgatggacgggtccg
H2P970_BOK-01       ctggagatgatccggcccagcgtctaccgcaacgtggcgcgtca--gctgcacatct---
H2PIQ6_BAK1-01      -----------ccgacccag-----------------------a--gatggtcaccttac
                               * * *** *                          * **  *   *   

H2NZJ1_BAX-01       gggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggccc
H2P970_BOK-01       ccctgcagtctgagcctgtggtg------accgatgcgttcctggccgtggctggccaca
H2PIQ6_BAK1-01      ctctgcaacct------------------agctatgagtacttcaccaagattgcctcca
                        ***  *                   * *  ** *    *      *   *    * 

H2NZJ1_BAX-01       ttttgcttcag---ggtttcatccaggatcgagcagggcgaat----ggggggggaggca
H2P970_BOK-01       tcttctctgca---ggcatcacatggggcaaggtggtgtccct----gtatgcggtggcc
H2PIQ6_BAK1-01      gcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggcttcggctacc
                       *   *      **  ***    **     *  * *    *    *     **   * 

H2NZJ1_BAX-01       cccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagc------
H2P970_BOK-01       gcggggctggccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtg
H2PIQ6_BAK1-01      gt----ctggccctacac-gtct---accagcgcggcctgac--------tggcttcctg
                          ****** *  **    *    *  *    * *   *           *      

H2NZJ1_BAX-01       gagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
H2P970_BOK-01       gactgcctgggggagttcgtgcgcaagac-cctggcaacctg--gctgcggagacg----
H2PIQ6_BAK1-01      ggccaggtgacgcgcttcgtggtcgactt-cat-gctgcatc--actgca-----t----
                    *      *   *    *** *  * *        *   * *    ****           

H2NZJ1_BAX-01       gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttt
H2P970_BOK-01       --tggcggatggactgatgtcctcaagtgtgtggt-----------cagc----------
H2PIQ6_BAK1-01      --tgcccggtggattg-----cacagaggggtggct----gggtggcagc----------
                       * *      *  *     * *      **              ****          

H2NZJ1_BAX-01       tctgacggcaacttcaactggggccgggttgtcgccctttggacattggacttcctccgg
H2P970_BOK-01       -----------acagaccctggcctccgctccca--ctg-----gctg------------
H2PIQ6_BAK1-01      -----------cctgaacttgggcaatggtcccatcctgaacgtgctg------------
                                   * *  ** *   * *  *   **        **            

H2NZJ1_BAX-01       gagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctacttt
H2P970_BOK-01       --gtagccgc-------actctgcagcttcgg---------------------ccgcttc
H2PIQ6_BAK1-01      --gtggttctgggtgtggttctg----ttggg---------------------ccagttt
                      *  *             **         **                     *   ** 

H2NZJ1_BAX-01       gggacgcccacgtggcagaccgtgaccatcttcgtggctggagtactcaccgcctcactc
H2P970_BOK-01       ctgaaggctgcct---------------tcttcgtg----------------------ct
H2PIQ6_BAK1-01      gtggtacgaagat---------------tcttc---------------------------
                      *         *               *****                           

H2NZJ1_BAX-01       accatctggaagaagatgggctga
H2P970_BOK-01       gctgccagagaga--------tga
H2PIQ6_BAK1-01      -------aaatca--------tga
                                *        ***

© 1998-2018