Dataset for CDS BOK of Organism Poecilia formosa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A087X4A6_BOK-01      atggagatgctgcggcgctcctccgtgttcgcggc---------cgaggt
A0A087XVV2_BOK-01      atggatgttctccggcgatcttcggtgttcgcctcggaggtcctcgatgt
                       *****  * ** ***** ** ** ********  *         *** **

A0A087X4A6_BOK-01      gttcgaccggtcgcccaccgacaaggagctggtgtcccaggctaaatcgc
A0A087XVV2_BOK-01      cttcgaccggtcgctgaccgagaaggagctggtgtctcagtccaaagcac
                        *************  ***** ************** *** * *** * *

A0A087X4A6_BOK-01      tgtgcagggactacatccactccaggctgaaccgcgtcgggattggctgg
A0A087XVV2_BOK-01      tttgcagagactatattctatccaggctcaaccagaacgggctgggttgg
                       * ***** ***** ** *  ******** ****    **** * ** ***

A0A087X4A6_BOK-01      tccagacctgagcagggagtggcggcgtcgggaggaaagctggcggaggt
A0A087XVV2_BOK-01      tccaagactgaaattaacttcttgcccccaagtgcagcgcttgccgaggt
                       ****   ****        *   * *  *  * * *  *** ** *****

A0A087X4A6_BOK-01      gtccctggtggttcagtggctgtgtgaggagttggagttcctccggccca
A0A087XVV2_BOK-01      gtccctggtgcttctttgtcttggcgatgagttggagtgcatacagccca
                       ********** ***  ** **  * ** ********** * * * *****

A0A087X4A6_BOK-01      acatttaccgcaatgtggcccggcagctgaacatcacggtgtcagtggag
A0A087XVV2_BOK-01      gtctgtacaggaacgtggcacggcagcttaacatttcagttgccatggag
                          * *** * ** ***** ******** *****  * **  *  *****

A0A087X4A6_BOK-01      ggcgtggtgtctgacgccttcatggctatcgctgcggacgtcttctcaac
A0A087XVV2_BOK-01      aacatggtttcagatgcctttctcggcgtggcaacggagatcttcgcagc
                         * **** ** ** *****  * *   * **  ****  ***** ** *

A0A087X4A6_BOK-01      aggagtgacgtggggaaaggtggtttccttgtacaccgtggcgggatccc
A0A087XVV2_BOK-01      aggtataacatggggtaaagtggttgccatgtatgcagtagctggagccc
                       ***  * ** ***** ** ****** ** ****  * ** ** *** ***

A0A087X4A6_BOK-01      tggcagtggactgtgtgcgccatggtcatccagccatgattgacaccatc
A0A087XVV2_BOK-01      tggcagtggactgcgtcagacagggacatcccaccacagtgcacatcata
                       ************* **  * ** ** *****  ***   *  *** *** 

A0A087X4A6_BOK-01      gtggactgcatgggggagtttgtccgcaagagtctgaccccctggttgaa
A0A087XVV2_BOK-01      gtggacagccttgggcagtttgtccgcaaatttctcgttccctggctgaa
                       ****** ** * *** *************   ***    ****** ****

A0A087X4A6_BOK-01      gaaaagaggaggctgggcggacatcacgaagtgcgtggtgaacaccggct
A0A087XVV2_BOK-01      gagacggggaggatgggcagagattatgaaatgcgtggtgaagatggact
                       ** * * ***** ***** ** ** * *** *********** *  * **

A0A087X4A6_BOK-01      cctccttacactcccactggttggtgtctgctgcctttgcattcggacat
A0A087XVV2_BOK-01      gcgctcctgaacgtccctggctgtcatcagtcatcgactccctgaaatat
                        * *     *    * **** **   ** *    *    *  *   * **

A0A087X4A6_BOK-01      tacctgaaggccgtggtgttgtaccttctcagagagaagtga
A0A087XVV2_BOK-01      tttctcactactgtgtacgtctacatcatgaaggagcagtga
                       *  ** *   * ***    * *** *  * *  *** *****

© 1998-2018