Dataset for CDS BAX-like of Organism Poecilia formosa

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A087YA89_BAX-01      atgg---------------------------------------------c
A0A096M0U4_BAX-01      atgaaaaggtcaaatttatatgcggaaatgttagaaaacaacatggcttc
A0A087XRM1_BAX-01      atgg-------cggacgaccgaggggactcggaactaga-----------
A0A087X4A6_BOK-01      atgg-------agatgctgcggcgctcctccgtgttcgcggc--------
A0A087XVV2_BOK-01      atgg-------atgttctccggcgatcttcggtgttcgcctcggaggtcc
                       ***                                               

A0A087YA89_BAX-01      agaaggaggtgga----------ggtgaccaaggaaattcatct------
A0A096M0U4_BAX-01      gggaggaaaagga----------gacgatcaagacacaggatcttttaaa
A0A087XRM1_BAX-01      -agacgagctggaaatgcaaggcgctgagggaggaggagatgtctttgac
A0A087X4A6_BOK-01      -cgaggtgttcga----ccggtcgcccaccgacaaggagctgg-------
A0A087XVV2_BOK-01      tcgatgtcttcga----ccggtcgctgaccgagaaggagctgg-------
                          * *     **          *   *   *                  

A0A087YA89_BAX-01      gatcagattgtggaagtcggagctgtgttgttgaaggacttcattttcga
A0A096M0U4_BAX-01      gataccatagtgaaacagctaattgtgttgttaaagaatttcatctggaa
A0A087XRM1_BAX-01      gaccccatcttggagcagggcgtggtggtgctcagagggtacgtgataga
A0A087X4A6_BOK-01      -----tgtcccaggctaaatcgctgtg-----cagggactacatccactc
A0A087XVV2_BOK-01      -----tgtctcagtccaaagcactttg-----cagagactatattctatc
                              *                 **      *     *   *      

A0A087YA89_BAX-01      gcggattcggcggcacgtagacagtaatgccatagtgaccagagagcagc
A0A096M0U4_BAX-01      gcagatcgaaagacgttcactgggtaatgctgaaatgattcggaaagtac
A0A087XRM1_BAX-01      gcgtataagcacggaggatcctggtcg--cca----tgtc-------gac
A0A087X4A6_BOK-01      caggctgaaccgcgtcgggattggctggtcca----gacctgagcaggga
A0A087XVV2_BOK-01      caggctcaaccagaacgggctgggttggtcca----agactgaaattaac
                            *                 *     *                    

A0A087YA89_BAX-01      tcggtgcacaggagctgtgtgacccaaaccacaagaagctcgctcagtgc
A0A096M0U4_BAX-01      tggacacaccgcagctcaataccccacagatgcaaaaaatctctcggtgt
A0A087XRM1_BAX-01      tctgtggatctgggaggaaggccaca----tgaacaagatgacccagaag
A0A087X4A6_BOK-01      gtggcggcgtcgggaggaaagc--------tggcggaggtgtccctggtg
A0A087XVV2_BOK-01      ttcttgcccccaagtgcagcgc--------ttgccgaggtgtccctggtg
                                    *                      *  *  * * *   

A0A087YA89_BAX-01      cttcagcagatcggagacgagctgg---------------------atgg
A0A096M0U4_BAX-01      ctccaggctgttggagatcaagtgg---------------------atgg
A0A087XRM1_BAX-01      ttaaagaagtggtg-gatcagctgctgaaaatagcagacgaactgaacag
A0A087X4A6_BOK-01      gttcagtggctgtgtgaggagttggagttcctccggcccaacatttaccg
A0A087XVV2_BOK-01      cttctttgtcttggcgatgagttggagtgcatacagcccagtctgtacag
                        *           * **  *  **                      *  *

A0A087YA89_BAX-01      aaacatggagctacaaaagatgataaac---gactccgccctgagcccgt
A0A096M0U4_BAX-01      agatg------tacaaagtgcaatgaaa---gatcaaacaatgcgtccct
A0A087XRM1_BAX-01      aaatgtagagttccagcgactgatcaaccaggtt--cagggaaactgt-g
A0A087X4A6_BOK-01      caatgtgg---cccggcagctgaacatcacggtgtcagtggagggcgtgg
A0A087XVV2_BOK-01      gaacgtgg---cacggcagcttaacatttcagttgccatggagaacatgg
                         *          *        *  *     *                  

A0A087YA89_BAX-01      caaaagacgtcttcatgaaagttgcctatcagatcttttctgatggtaga
A0A096M0U4_BAX-01      cattagagaactacatcaaagttgtcctcgggatcttttcagacggtgaa
A0A087XRM1_BAX-01      cgaaggaagtcttcatgatggtggccaggagcatctttattgatggca--
A0A087X4A6_BOK-01      tgtctgacgccttcatggctatcgctgcggacgtcttctcaacaggag--
A0A087XVV2_BOK-01      tttcagatgcctttctcggcgtggcaacggagatcttcgcagcaggta--
                            **   **   *     * *         ****       **    

A0A087YA89_BAX-01      ttcaactggggccgagtggttgcgctctttta-----------cttcgcc
A0A096M0U4_BAX-01      atcaactggggcagggtggttacagtattttc-----------ctttacc
A0A087XRM1_BAX-01      -ttaactggggccgggtggt-------------------ggggctctttc
A0A087X4A6_BOK-01      -tgacgtggggaaaggtggtttccttgtacaccgtggcgggatccctggc
A0A087XVV2_BOK-01      -taacatggggtaaagtggttgccatgtatgcagtagctggagccctggc
                        * *  *****    *****                       *     *

A0A087YA89_BAX-01      tgtcgact----------cgtcataaaagcccttg-taaccaaaattcct
A0A096M0U4_BAX-01      tgcctatt----------tgttttgaaggcatacg-aagacaacattttt
A0A087XRM1_BAX-01      atctggcttacagactcatat---acagggccctcaccaccaaccatctg
A0A087X4A6_BOK-01      agtggact---------gtgtgcgccatggtcatc-cagcca------tg
A0A087XVV2_BOK-01      agtggact---------gcgtcagacagggacatc-ccacca------ca
                              *            *     * *           **        

A0A087YA89_BAX-01      gatatcatcagaacaataattaac-tggacaatagactacctccgggacc
A0A096M0U4_BAX-01      gacatgataaaaaacataatcaac-tggaccgtagattatttccggaata
A0A087XRM1_BAX-01      gagaacatcaggatggtgatcagc-tgggtcctgcaggtcatcagggagt
A0A087X4A6_BOK-01      attgacacc---atcgtggactgcatggg----ggagtttgtccgcaaga
A0A087XVV2_BOK-01      gtgcacatc---atagtggacagccttgg----gcagtttgtccgcaaat
                             *     *   *      * * *       *     ** *  *  

A0A087YA89_BAX-01      acgtgatcaactggataagagagcaaggtggctgggagggaatt------
A0A096M0U4_BAX-01      cggttgtcaactggatacgagatcaaggtggctgggaggggatt------
A0A087XRM1_BAX-01      tgctgtacccctggctggtgcagcaggggggatgggttggtgtcatccaa
A0A087X4A6_BOK-01      gtctgaccccctggttgaagaaaagaggaggctgggcggacatcacgaag
A0A087XVV2_BOK-01      ttctcgttccctggctgaagagacggggaggatgggcagagattatgaaa
                          *      **** *          ** ** ****  *   *       

A0A087YA89_BAX-01      ---------------cgttcctacttcggcactcccacttggcagacatt
A0A096M0U4_BAX-01      ---------------tactcttaccttggcactcccacatggcaaacggt
A0A087XRM1_BAX-01      agctt---------------------------tccatggaggaacgcagc
A0A087X4A6_BOK-01      tgcgtggtgaacaccggctcctccttacactcccactggttggtgtctgc
A0A087XVV2_BOK-01      tgcgtggtgaagatggactgcgctcctgaacgtccctggctgtcatcagt
                                                        *       *    *   

A0A087YA89_BAX-01      gggggttttcctggccggtgttcttaccactgctttagtcatgcgcaaga
A0A096M0U4_BAX-01      ggcagtttttctggctggcgttctcaccacccttttcatcacccacaatg
A0A087XRM1_BAX-01      catagttgc-ttcaattgttg--tagtagcaacatttgtttactacagaa
A0A087X4A6_BOK-01      tgcctttgcattcggacattacctgaaggccgtggtgttgtaccttctca
A0A087XVV2_BOK-01      catcgactccctgaaatattttctcactactgtgtacgtctacatcatga
                                  *           *     *        *           

A0A087YA89_BAX-01      tg---------tga
A0A096M0U4_BAX-01      cgaggcgtccatga
A0A087XRM1_BAX-01      tgaaacac---tga
A0A087X4A6_BOK-01      gagagaag---tga
A0A087XVV2_BOK-01      aggagcag---tga
                                  ***

© 1998-2018