Dataset for CDS BAX of Organism Poecilia formosa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A087XRM1_BAX-01      atgg---------------------------cggacgaccgaggggactc
A0A087YA89_BAX-01      atgg---------------------------------------------c
A0A096M0U4_BAX-01      atgaaaaggtcaaatttatatgcggaaatgttagaaaacaacatggcttc
                       ***                                              *

A0A087XRM1_BAX-01      ggaactagaagacgagctggaaatgcaaggcgctgagggaggaggagatg
A0A087YA89_BAX-01      agaa--------------ggaggtg-gaggtgaccaaggaaattca----
A0A096M0U4_BAX-01      ggga--------------ggaaaag-gagacgatcaagacacagga----
                        * *              ***   *  **  *   * *       *    

A0A087XRM1_BAX-01      tct-ttgacgaccccatcttggagcagggcgtggtggtgctcagagggta
A0A087YA89_BAX-01      tct------gatcagattgtggaagtcggagctgtgttgttgaaggactt
A0A096M0U4_BAX-01      tcttttaaagataccatagtgaaacagctaattgtgttgttaaagaattt
                       ***      **    **  ** *          *** ** * *     * 

A0A087XRM1_BAX-01      cgtgatagagcgtat------aagcacggaggatcctggtcgccatgtcg
A0A087YA89_BAX-01      cattttcgagcggattcggcggcacgtagacagtaatg------------
A0A096M0U4_BAX-01      catctggaagcagatcgaaagacgttcactgggtaatg------------
                       * *     ***  **                  *  **            

A0A087XRM1_BAX-01      actctgtggatctgggaggaa----ggccacatgaacaagatgacccaga
A0A087YA89_BAX-01      -ccatagtgaccagagagcagctcggtgcacaggagctgtgtgacccaaa
A0A096M0U4_BAX-01      -ctgaaatgattcggaaagtactggacacaccgcagctcaataccccaca
                        *      **   *  *           ***   * *    *  **** *

A0A087XRM1_BAX-01      agttaaagaagtggtggatcagctgctgaaaatagcagacgaactgaaca
A0A087YA89_BAX-01      ccacaagaagctcgctcagtgccttcagcagatcggagacgagctggatg
A0A096M0U4_BAX-01      gatgcaaaaaatctctcggtgtctccaggctgttggagatcaagtggatg
                            *  *  *          ** * *    * * ***  *  ** *  

A0A087XRM1_BAX-01      gaaatgtagagttccagcgactgatcaaccaggttcag---ggaaactgt
A0A087YA89_BAX-01      gaaacatggagctacaaaagatgataaac--gactccgccctgagcccgt
A0A096M0U4_BAX-01      gagatg------tacaaagtgcaatgaaa--gatcaaacaatgcgtccct
                       ** *        * **       ** **   *          *   *  *

A0A087XRM1_BAX-01      gcgaaggaagtcttcatgatggtggccaggagcatctttattgatggca-
A0A087YA89_BAX-01      -caaaagacgtcttcatgaaagttgcctatcagatcttttctgatggtag
A0A096M0U4_BAX-01      -cattagagaactacatcaaagttgtcctcgggatcttttcagacggtga
                        *    **   ** *** *  ** * *      ******   ** **   

A0A087XRM1_BAX-01      --ttaactggggccgggtggtggggctctttcatctggcttacagactca
A0A087YA89_BAX-01      attcaactggggccgagtggttgcgctcttttacttcgcctgtcgactcg
A0A096M0U4_BAX-01      aatcaactggggcagggtggttacagtattttcctttacctgcctatttg
                         * ********* * *****     * ***    *  * *    * *  

A0A087XRM1_BAX-01      tatacagggccctcaccaccaaccatctggagaacatcaggatggtgatc
A0A087YA89_BAX-01      tcataaaagcccttgtaaccaaaattcctgatatcatcagaacaataatt
A0A096M0U4_BAX-01      ttttgaaggcatacgaagacaacatttttgacatgataaaaaacataatc
                       *    *  **         ***   *   ** *  ** *  *   * ** 

A0A087XRM1_BAX-01      agctgggtcctgcaggtcatcagggagttgctgtacccctggctggtgca
A0A087YA89_BAX-01      aactggacaatagactacctccgggaccacgtgatcaactggataagaga
A0A096M0U4_BAX-01      aactggaccgtagattatttccggaatacggttgtcaactggatacgaga
                       * ****    *  *     ** ** *     *   *  **** *     *

A0A087XRM1_BAX-01      gcaggggggatggg------ttggtgtcatccaaagctttccatggagga
A0A087YA89_BAX-01      gcaaggtggctgggagggaattcgttcctacttcggcactcccacttggc
A0A096M0U4_BAX-01      tcaaggtggctgggaggggatttactcttaccttggcactcccacatggc
                        ** ** ** ****      **        *    **  ***     ** 

A0A087XRM1_BAX-01      acgcagccatagttgcttcaattgttgtagtagcaaca---tttgtttac
A0A087YA89_BAX-01      agacattgggggttttcctggccggtgttcttaccactgctttagtcatg
A0A096M0U4_BAX-01      aaacggtggcagtttttctggctggcgttctcaccacccttttcatcacc
                       *  *       ***         *  **  *  * **    **  *    

A0A087XRM1_BAX-01      tacagaatgaaacac---tga
A0A087YA89_BAX-01      cgcaagatg---------tga
A0A096M0U4_BAX-01      cacaatgcgaggcgtccatga
                         **    *         ***

© 1998-2019