Dataset for CDS BAX-like of Organism Pelodiscus sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


K7FJF5_BOK-01       atggaggtgctgcgccgttcctcggtcttcgctgcggaggtgatggaggtgtttgac---
K7G4J1_BAK1-01      --agaagggcttccctcactccggcgcaccccaggggagctgcc-----tgcctgactct
                       ** * *** * *     *  *  *  * * * **** **       **  ****   

K7FJF5_BOK-01       --cggtcg-----cccaccgacaaggagctggtgtccca------ggccaaggtgctctg
K7G4J1_BAK1-01      gtcagtcgttgtctcttcctcagaagatcaagtggcccgtgagacggaggaggtgttcca
                      * ****      *  **    * ** *  *** ***       **   ***** **  

K7FJF5_BOK-01       cagagactacatccattcccggctgctccgggccagcctgg---gctggagcaaagcaga
K7G4J1_BAK1-01      gagctatgccttcca-------ccgctaccagcaagagagggaagcgggcggagaggagg
                     **  *   * ****       * *** *  ** **   **   ** ** * * ** ** 

K7FJF5_BOK-01       gcacaacgcacccacccctggtggcaggctggctgaggtgtccagcgt----------gc
K7G4J1_BAK1-01      tgccgatggaccc-----------cgagatcgcagag--atccagcaggagacgggcagc
                       * * * ****           *  * * ** ***   ******            **

K7FJF5_BOK-01       ttctgcagctaggggacgag----ctggagtacatccg------ccccaac-----gtct
K7G4J1_BAK1-01      accagcagccaggtgggcagacgcctggccctcatcggagatgacatcaacatgcggtat
                      * ***** *** *   **    ****    **** *      *  ****     ** *

K7FJF5_BOK-01       atcgcaacgtcgcccgcca-gctgaacatcgcgctgcactccgagagcgtggtgactgac
K7G4J1_BAK1-01      gacgcagagttccggaacatgctgaagaccttgcagcccacaaaggacaacgcctacgag
                      ****  **  *    ** ****** * *  ** ** * *  **  *   *     ** 

K7FJF5_BOK-01       gccttcctggcggtggccgcccagatcttc----gcagcaggtaccgagcc----cgtct
K7G4J1_BAK1-01      tactttaccaagatagcctccagcttgtttgacagcggcattaactggggcagggtgatt
                      ***      * * *** **    * **     ** ***   ** * * *     *  *

K7FJF5_BOK-01       gggctggctttgatttatctcttttctctattgcaaggtggtgtgcggtggactgcgtca
K7G4J1_BAK1-01      gcgct-gctggggt------------tcggttaccggatggcaatccatgtataccagca
                    * *** ***  * *            **  ** *  * ***    *  ** *   *  **

K7FJF5_BOK-01       -ggcaggcccagcccgcaatggtgcacatcatcgtggactgcctgggcgagtttg---tc
K7G4J1_BAK1-01      cgggatgaccggcttcctccgg-----agcattgcccgctacgtggcagatttcgtgctc
                     ** * * ** **   *   **     * *** *    ** * ***  ** ** *   **

K7FJF5_BOK-01       cgcaagtccttggtgacgtggctgaaaaggcgaggaggctgggcagacatcacaaagtgc
K7G4J1_BAK1-01      cgcaatcgcattgcccagtggattgcccagcagggaggatgggt-ggcagcat-------
                    *****   * * *    **** *      **  ***** ****  * ** **        

K7FJF5_BOK-01       gtggtgaacacggatcccagccttcgctcccattggctcgtggc--tgccatctgtagct
K7G4J1_BAK1-01      ----tggacttggat---aatgtttatgtgaagtacatgatggtggtgctggtcgtggtc
                        ** **  ****   *   **       * *   *  ***   ***     ** *  

K7FJF5_BOK-01       tt----ggtcacttcct--taaggccgtcttctttgtgctgctgccagagagatga
K7G4J1_BAK1-01      ctgctgggtcagttggtggtacgg-cgctttttcagctc-------------gtga
                     *    ***** **  *  ** ** **  ** *  *  *              ***

© 1998-2018