Dataset for CDS BAX-like of Organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3LYL4_BOK-01       atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggat
A0A2I3MLN0_BAX-04       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2I3MLN0_BAX-02       atggacgggtccggggagcagcccag--------aggcggggt-------
A0A2I3MLN0_BAX-01       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2I3MLN0_BAX-03       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2I3MUA8_BAK1-01      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2I3MUA8_BAK1-02      ----atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggag
A0A2I3LG80_BAK1-02      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
A0A2I3LG80_BAK1-01      ----atggcatcagggcaaggcccagggtttcccaggcaggagtgcggag
                            * **      *      * * *         * *  *         

A0A2I3LYL4_BOK-01       gcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggc
A0A2I3MLN0_BAX-04       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2I3MLN0_BAX-02       ----------gaca-ccccgttctga------------------------
A0A2I3MLN0_BAX-01       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2I3MLN0_BAX-03       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2I3MUA8_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2I3MUA8_BAK1-02      agcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacaga
A0A2I3LG80_BAK1-02      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
A0A2I3LG80_BAK1-01      agcttgccctgccc-tctgcttctgaggagcaggtaacccgggacatgga
                                  *     *        *                        

A0A2I3LYL4_BOK-01       gctgg------------------------gccgggagtacgtgcacgcgc
A0A2I3MLN0_BAX-04       ggccctttt----------gcttcagggtttcatc--caggatcgagcag
A0A2I3MLN0_BAX-02       -----ttct----------gcaccctcactccatc--cccactcta----
A0A2I3MLN0_BAX-01       ggccctttt----------gcttcagggtttcatc--caggatcgagcag
A0A2I3MLN0_BAX-03       ggccctttt----------gcttcagg-----------------------
A0A2I3MUA8_BAK1-01      ggaggttttccgcagctacgttttttaccgccatcagcaggagca-----
A0A2I3MUA8_BAK1-02      ggaggttttccgcagctacgttttttaccgccatcagcaggagca-----
A0A2I3LG80_BAK1-02      gaag---------------gtttttgaccgccatcagcaggaaca-----
A0A2I3LG80_BAK1-01      gaag---------------gtttttgaccgccatcagcaggaaca-----

A0A2I3LYL4_BOK-01       ggctactg----------cgcgccggcctctcctggagcgcgcccgagcg
A0A2I3MLN0_BAX-04       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2I3MLN0_BAX-02       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2I3MLN0_BAX-01       ggcgaatggggggggagacacccgagctggccctggacccggtgc---ct
A0A2I3MLN0_BAX-03       --------------------------------------------------
A0A2I3MUA8_BAK1-01      ggaggctgaaggggcggctgcccctgctgatccagagatggacac---ct
A0A2I3MUA8_BAK1-02      ggaggctgaaggggcggctgcccctgctgatccagagatggacac---ct
A0A2I3LG80_BAK1-02      ggaagctgaag---------------------------------------
A0A2I3LG80_BAK1-01      ggaagctgaagggccagccgcccctgccgacccagagatggtcac---ct

A0A2I3LYL4_BOK-01       cgccgcgcctgtcccgggacgcc-tggccgaggtgtgcgcggtgctcctg
A0A2I3MLN0_BAX-04       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2I3MLN0_BAX-02       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2I3MLN0_BAX-01       --------caggatgcgtccaccaagaggc---tgagcgagtgtctcaag
A0A2I3MLN0_BAX-03       --------------------------------------------------
A0A2I3MUA8_BAK1-01      tgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgcc
A0A2I3MUA8_BAK1-02      tgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgcc
A0A2I3LG80_BAK1-02      ---------------gcagcaccgtggggcaggtgggacggcagatcgcc
A0A2I3LG80_BAK1-01      tgcccctccaacctagcagcaccgtggggcaggtgggacggcagatcgcc

A0A2I3LYL4_BOK-01       cgcctgggggatgagctgga--gatgatccggcccagcgtctaccgcaac
A0A2I3MLN0_BAX-04       cgcatcggggacgaactggacag------taacatggagct--gcagagg
A0A2I3MLN0_BAX-02       cgcatcggggacgaactggacag------taacatggagct--gcagagg
A0A2I3MLN0_BAX-01       cgcatcggggacgaactggacag------taacatggagct--gcagagg
A0A2I3MLN0_BAX-03       ------------------------------------------------gg
A0A2I3MUA8_BAK1-01      atcatcggggacgacatcaaccgacgctatgactcagagtt--ccagacc
A0A2I3MUA8_BAK1-02      atcatcggggacgacatcaaccgacgctatgactcagagtt--ccagacc
A0A2I3LG80_BAK1-02      atcatctgggatgacatcaatcggcgctatgactcggagtt--ccagacc
A0A2I3LG80_BAK1-01      atcatctgggatgacatcaatcggcgctatgactcggagtt--ccagacc

A0A2I3LYL4_BOK-01       gtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccga
A0A2I3MLN0_BAX-04       atgat--------tg--ccgccgtggacacagactcccc-------ccga
A0A2I3MLN0_BAX-02       atgat--------tg--ccgccgtggacacagactcccc-------ccga
A0A2I3MLN0_BAX-01       atgat--------tg--ccgccgtggacacagactcccc-------ccga
A0A2I3MLN0_BAX-03       atgat--------tg--ccgccgtggacacagactcccc-------ccga
A0A2I3MUA8_BAK1-01      atgctgcagcagctg--cagcccacggcagagaacgcct-------atga
A0A2I3MUA8_BAK1-02      atgctgcagcagctg--cagcccacggcagagaacgcct-------atga
A0A2I3LG80_BAK1-02      atgctgcagcacctg--cagcccacagcagagaacgcct-------acga
A0A2I3LG80_BAK1-01      atgctgcagcacctg--cagcccacagcagagaacgcct-------acga
                         **          **  *  *      **       **          **

A0A2I3LYL4_BOK-01       tgcgttcctggccg---tggctgg--------------------ccacat
A0A2I3MLN0_BAX-04       gaggtctttttccgag-tggcagc--------------------tgacat
A0A2I3MLN0_BAX-02       gaggtctttttccgag-tggcagc--------------------tgacat
A0A2I3MLN0_BAX-01       gaggtctttttccgag-tggcagc--------------------tgacat
A0A2I3MLN0_BAX-03       gaggtctttttccgag-tggcagc--------------------tgacat
A0A2I3MUA8_BAK1-01      ---gtacttcaccaagattgcctc--------------------cagcct
A0A2I3MUA8_BAK1-02      ---gtacttcaccaagattgcctccaggccagcagcaacacccacagcct
A0A2I3LG80_BAK1-02      ---gtacttcaccaagatcgcctc--------------------cagcct
A0A2I3LG80_BAK1-01      ---gtacttcaccaagatcgcctc--------------------cagcct
                           **   *  **    * **                          * *

A0A2I3LYL4_BOK-01       cttctctgcagg---catcacgtggggcaaggtggt-gtccctgtatgcg
A0A2I3MLN0_BAX-04       gttttctgacggcaacttcaactggggccgtgttgtcgcccttttctact
A0A2I3MLN0_BAX-02       gttttctgacggcaacttcaactggggccgtgttgtcgcccttttctact
A0A2I3MLN0_BAX-01       gttttctgacggcaacttcaactggggccgtgttgtcgcccttttctact
A0A2I3MLN0_BAX-03       gttttctgacggcaacttcaactggggccgtgttgtcgcccttttctact
A0A2I3MUA8_BAK1-01      gtt---tgagagtggcatcaactggggccgtgtggtggctcttctgggct
A0A2I3MUA8_BAK1-02      gtt---tgagagtggcatcaactggggccgtgtggtggctcttctgggct
A0A2I3LG80_BAK1-02      gtt---tgagagtggcatcaaccagggccgtgtggtggctctcctgggct
A0A2I3LG80_BAK1-01      gtt---tgagagtggcatcaaccagggccgtgtggtggctctcctgggct
                         **   **   *   * ***    ****   ** ** *  *   *   * 

A0A2I3LYL4_BOK-01       gtggccgcggggctggccgt--ggactgtgtgaggcaggcccagcctgcc
A0A2I3MLN0_BAX-04       ttgccagc-aaactggtgctcaaggccctgtgtaccaaggt--gcccgaa
A0A2I3MLN0_BAX-02       ttgccagc-aaactggtgctcaaggccctgtgtaccaaggt--gcccgaa
A0A2I3MLN0_BAX-01       ttgccagc-aaactggtgctcaaggccctgtgtaccaaggt--gcccgaa
A0A2I3MLN0_BAX-03       ttgccagc-aaactggtgctcaaggccctgtgtaccaaggt--gcccgaa
A0A2I3MUA8_BAK1-01      ttggctac-cgtctggccct-----acacgtctaccagcac--ggcctga
A0A2I3MUA8_BAK1-02      ttggctac-cgtctggccct-----acacgtctaccagcac--ggcctga
A0A2I3LG80_BAK1-02      tcggctac-cgtctggccct-----acatgtctaccagcgc--ggcttga
A0A2I3LG80_BAK1-01      tcggctac-cgtctggccct-----acatgtctaccagcgc--ggcttga
                          * *  *    ****   *         **    **      * *    

A0A2I3LYL4_BOK-01       atggtccacgccctcgtggactgcctgggggagtttgtgcgcaagaccct
A0A2I3MLN0_BAX-04       ctgatcagaaccatcatgggctggacactggacttcctccgggagcggct
A0A2I3MLN0_BAX-02       ctgatcagaaccatcatgggctggacactggacttcctccgggagcggct
A0A2I3MLN0_BAX-01       ctgatcagaaccatcatgggctggacactggacttcctccgggagcggct
A0A2I3MLN0_BAX-03       ctgatcagaaccatcatgggctggacactggacttcctccgggagcggct
A0A2I3MUA8_BAK1-01      ctgg-------cttcctgggccaggt----gacccgcttcgtggtcgact
A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3LG80_BAK1-02      ctgg-------cttcctgggccaggt----gacccgcttcgtggt---ct
A0A2I3LG80_BAK1-01      ctgg-------cttcctgggccaggt----gacccgcttcgtggt---ct

A0A2I3LYL4_BOK-01       ggcaa-------------------cctggctgcggagacgcggcggatgg
A0A2I3MLN0_BAX-04       gttgg-------------------gctggatccaagaccagggtggttgg
A0A2I3MLN0_BAX-02       gttgg-------------------gctggatccaagaccagggtggttgg
A0A2I3MLN0_BAX-01       gttgg-------------------gctggatccaagaccagggtggttgg
A0A2I3MLN0_BAX-03       gttgg-------------------gctggatccaagaccagggtggttgg
A0A2I3MUA8_BAK1-01      tcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgg
A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3LG80_BAK1-02      tcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctgg
A0A2I3LG80_BAK1-01      tcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctgg

A0A2I3LYL4_BOK-01       actgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctccca
A0A2I3MLN0_BAX-04       gtgagactcctcaaccctc---------ctcaccccaaccaccgcccctg
A0A2I3MLN0_BAX-02       gacggcctcctc------t---------cctactttgg--gacgcccacg
A0A2I3MLN0_BAX-01       gacggcctcctc------t---------cctactttgg--gacgcccacg
A0A2I3MLN0_BAX-03       gacggcctcctc------t---------cctactttgg--gacgcccacg
A0A2I3MUA8_BAK1-01      gtggcagccct-------g------------aacttgggcaatggtc---
A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3LG80_BAK1-02      gtggcagccct-------g------------gacttgggcaatggtc---
A0A2I3LG80_BAK1-01      gtgtcaagtct-------g---------aaaaacctgcacatccctccct

A0A2I3LYL4_BOK-01       ctggctggtagccgcactctgcagcttcggccgcttcctgaaggctgcct
A0A2I3MLN0_BAX-04       c-----cccactgtccctgcccacccccggtcaca--------gtggtgc
A0A2I3MLN0_BAX-02       t-----ggca--gaccgtgacca-tcttggtggct--------ggagtac
A0A2I3MLN0_BAX-01       t-----ggca--gaccgtgacca-tcttggtggct--------ggagtac
A0A2I3MLN0_BAX-03       t-----ggca--gaccgtgacca-tcttggtggct--------ggagtac
A0A2I3MUA8_BAK1-01      -------cca----tcctgaacg-tgctggtggtt--ctgggtgtggttc
A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3LG80_BAK1-02      -------cca----tcctgaaca-tgctggtgatt--ctgggggtggttc
A0A2I3LG80_BAK1-01      c-----tcca----gcctccccg-cctcatccattccccagggatgattc

A0A2I3LYL4_BOK-01       tcttcgtgctgctg-------ccagagagatga-----------------
A0A2I3MLN0_BAX-04       cctctccccatctttggatcatcag-----atgtggtctataatgcattt
A0A2I3MLN0_BAX-02       tcaccgcctccctc---accatctggaagaagatgggctga---------
A0A2I3MLN0_BAX-01       tcaccgcctccctc---accatctggaagaagatgggctga---------
A0A2I3MLN0_BAX-03       tcaccgcctccctc---accatctggaagaagatgggctga---------
A0A2I3MUA8_BAK1-01      tgttgggccagttt-------gtggtacgaagattcttcaaat--catga
A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3LG80_BAK1-02      tgttgggcccgttt-------gtggtacaaagattcttcaaat--catga
A0A2I3LG80_BAK1-01      tttt--acctgctt--------caatgctattgttgagcaacttctataa

A0A2I3LYL4_BOK-01       ------------
A0A2I3MLN0_BAX-04       ccttatgtgtct
A0A2I3MLN0_BAX-02       ------------
A0A2I3MLN0_BAX-01       ------------
A0A2I3MLN0_BAX-03       ------------
A0A2I3MUA8_BAK1-01      ------------
A0A2I3MUA8_BAK1-02      ------------
A0A2I3LG80_BAK1-02      ------------
A0A2I3LG80_BAK1-01      ------------

© 1998-2019