Dataset for CDS BAX of Organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3MLN0_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I3MLN0_BAX-02      atggacgggtccggggagcagcccagaggcggggtgacaccccgttctga
A0A2I3MLN0_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I3MLN0_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       ********************************** * *  ** * *****

A0A2I3MLN0_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2I3MLN0_BAX-02      -----------------------ttctgcaccctcactccatccccactc
A0A2I3MLN0_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2I3MLN0_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
                                              ** ***  *                  

A0A2I3MLN0_BAX-04      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2I3MLN0_BAX-02      ta----ggcgaatggggggggagacacccgagctggccctggacccggtg
A0A2I3MLN0_BAX-03      --------------------------------------------------
A0A2I3MLN0_BAX-01      gagcagggcgaatggggggggagacacccgagctggccctggacccggtg
                                                                         

A0A2I3MLN0_BAX-04      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2I3MLN0_BAX-02      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2I3MLN0_BAX-03      --------------------------------------------------
A0A2I3MLN0_BAX-01      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
                                                                         

A0A2I3MLN0_BAX-04      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I3MLN0_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I3MLN0_BAX-03      --------------------------------ggatgattgccgccgtgg
A0A2I3MLN0_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
                                                       ******************

A0A2I3MLN0_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I3MLN0_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I3MLN0_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I3MLN0_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2I3MLN0_BAX-04      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2I3MLN0_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2I3MLN0_BAX-03      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2I3MLN0_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
                       **************************************************

A0A2I3MLN0_BAX-04      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2I3MLN0_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2I3MLN0_BAX-03      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2I3MLN0_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
                       **************************************************

A0A2I3MLN0_BAX-04      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2I3MLN0_BAX-02      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2I3MLN0_BAX-03      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2I3MLN0_BAX-01      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
                       **************************************************

A0A2I3MLN0_BAX-04      tggatccaagaccagggtggttgggtgagactcctcaaccctcctcaccc
A0A2I3MLN0_BAX-02      tggatccaagaccagggtggttgggacggcctcctc------tcctactt
A0A2I3MLN0_BAX-03      tggatccaagaccagggtggttgggacggcctcctc------tcctactt
A0A2I3MLN0_BAX-01      tggatccaagaccagggtggttgggacggcctcctc------tcctactt
                       *************************   * ******       *  **  

A0A2I3MLN0_BAX-04      caaccaccgcccctgccccactgtccctgcccacccccggtcacagtggt
A0A2I3MLN0_BAX-02      tgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctggagt
A0A2I3MLN0_BAX-03      tgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctggagt
A0A2I3MLN0_BAX-01      tgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctggagt
                              *****  *   **  * ** ** ***  *  ***  * *  **

A0A2I3MLN0_BAX-04      gccctctccccatctttggatcatcag-----atgtggtctataatgcat
A0A2I3MLN0_BAX-02      actcaccgcctccctc---accatctggaagaagatgggctga-------
A0A2I3MLN0_BAX-03      actcaccgcctccctc---accatctggaagaagatgggctga-------
A0A2I3MLN0_BAX-01      actcaccgcctccctc---accatctggaagaagatgggctga-------
                        * * *  **   **    * **** *     *  *** **         

A0A2I3MLN0_BAX-04      ttccttatgtgtct
A0A2I3MLN0_BAX-02      --------------
A0A2I3MLN0_BAX-03      --------------
A0A2I3MLN0_BAX-01      --------------
                                     

© 1998-2018