Dataset for CDS BAK1 of Organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3MUA8_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2I3MUA8_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2I3LG80_BAK1-02      atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagct
A0A2I3LG80_BAK1-01      atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagct
                        ***** ** ** ***********   ************ ********** 

A0A2I3MUA8_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2I3MUA8_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2I3LG80_BAK1-02      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2I3LG80_BAK1-01      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
                        ******************************* *********  *** ** 

A0A2I3MUA8_BAK1-02      ttttccgcagctacgttttttaccgccatcagcaggagcaggaggctgaa
A0A2I3MUA8_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggagcaggaggctgaa
A0A2I3LG80_BAK1-02      --------------gtttttgaccgccatcagcaggaacaggaagctgaa
A0A2I3LG80_BAK1-01      --------------gtttttgaccgccatcagcaggaacaggaagctgaa
                                      ****** **************** ***** ******

A0A2I3MUA8_BAK1-02      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
A0A2I3MUA8_BAK1-01      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
A0A2I3LG80_BAK1-02      g-------------------------------------------------
A0A2I3LG80_BAK1-01      gggccagccgcccctgccgacccagagatggtcaccttgcccctccaacc

A0A2I3MUA8_BAK1-02      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
A0A2I3MUA8_BAK1-01      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
A0A2I3LG80_BAK1-02      --gcagcaccgtggggcaggtgggacggcagatcgccatcatctgggatg
A0A2I3LG80_BAK1-01      tagcagcaccgtggggcaggtgggacggcagatcgccatcatctgggatg
                          ******** ******************** *********** **** *

A0A2I3MUA8_BAK1-02      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
A0A2I3MUA8_BAK1-01      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
A0A2I3LG80_BAK1-02      acatcaatcggcgctatgactcggagttccagaccatgctgcagcacctg
A0A2I3LG80_BAK1-01      acatcaatcggcgctatgactcggagttccagaccatgctgcagcacctg
                        ******* ** *********** *********************** ***

A0A2I3MUA8_BAK1-02      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctccag
A0A2I3MUA8_BAK1-01      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
A0A2I3LG80_BAK1-02      cagcccacagcagagaacgcctacgagtacttcaccaagatcgcctc---
A0A2I3LG80_BAK1-01      cagcccacagcagagaacgcctacgagtacttcaccaagatcgcctc---
                        ******** ************** ***************** *****   

A0A2I3MUA8_BAK1-02      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
A0A2I3MUA8_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
A0A2I3LG80_BAK1-02      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2I3LG80_BAK1-01      -----------------cagcctgtttgagagtggcatcaaccagggccg
                                         *************************  ******

A0A2I3MUA8_BAK1-02      tgtggtggctcttctgggctttggctaccgtctggccctacacgtctacc
A0A2I3MUA8_BAK1-01      tgtggtggctcttctgggctttggctaccgtctggccctacacgtctacc
A0A2I3LG80_BAK1-02      tgtggtggctctcctgggcttcggctaccgtctggccctacatgtctacc
A0A2I3LG80_BAK1-01      tgtggtggctctcctgggcttcggctaccgtctggccctacatgtctacc
                        ************ ******** ******************** *******

A0A2I3MUA8_BAK1-02      agcacggcctga--------------------------------------
A0A2I3MUA8_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
A0A2I3LG80_BAK1-02      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
A0A2I3LG80_BAK1-01      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
                        *** **** ***                                      

A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3MUA8_BAK1-01      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg
A0A2I3LG80_BAK1-02      ttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctg
A0A2I3LG80_BAK1-01      ttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctg

A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3MUA8_BAK1-01      ggtggcagccctg---aacttgggcaatggtc-----ccatcctgaacgt
A0A2I3LG80_BAK1-02      ggtggcagccctg---gacttgggcaatggtc-----ccatcctgaacat
A0A2I3LG80_BAK1-01      ggtgtcaagtctgaaaaacctgcacatccctccctctccagcctccccgc

A0A2I3MUA8_BAK1-02      --------------------------------------------------
A0A2I3MUA8_BAK1-01      gctggtggtt--ctgggtgtggttctgttgggccagtttgtggtacgaag
A0A2I3LG80_BAK1-02      gctggtgatt--ctgggggtggttctgttgggcccgtttgtggtacaaag
A0A2I3LG80_BAK1-01      ctcatccattccccagggatgattctttt--acctgctt-caatgctatt

A0A2I3MUA8_BAK1-02      ------------------
A0A2I3MUA8_BAK1-01      attcttcaaat--catga
A0A2I3LG80_BAK1-02      attcttcaaat--catga
A0A2I3LG80_BAK1-01      gttgagcaacttctataa

© 1998-2019