Dataset for CDS BAX-like of Organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2REG3_BOK-01           atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2I3TUX1_BAX-03       atggacg-ggtccggggagcagcccag--------aggcggggg------
A0A2I3TUX1_BAX-01       atggacg-ggtccggggagcagcccag--------aggcggggg------
A0A2I3TUX1_BAX-02       atggacg-ggtccggggagca-----------------------------
A0A2I3SNH6_BAK1-01      ----atg-gcatcggggcaaggcccagggcctcccaggcaggagtgcgga
A0A2I3T6V0_BAK1-02      ----atg-gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
A0A2I3T6V0_BAK1-03      ----atg-gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
A0A2I3T6V0_BAK1-01      ----atg-gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
                            * * *   *** *                                 

H2REG3_BOK-01           cgcctttgaccgctcgcccacagacaaggagctggtggcccaggcca---
A0A2I3TUX1_BAX-03       -----------gccc-accagctctgagcagatcatga--------agac
A0A2I3TUX1_BAX-01       -----------gccc-accagctctgagcagatcatga--------agac
A0A2I3TUX1_BAX-02       --------------------------------------------------
A0A2I3SNH6_BAK1-01      aagcctgccctgccc-tctgcttctgagga--------------------
A0A2I3T6V0_BAK1-02      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
A0A2I3T6V0_BAK1-03      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
A0A2I3T6V0_BAK1-01      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
                                                                          

H2REG3_BOK-01           aggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctc
A0A2I3TUX1_BAX-03       aggggccctttt--------------------------------------
A0A2I3TUX1_BAX-01       aggggcccttttgcttcagggt--------------ttcatccaggatcg
A0A2I3TUX1_BAX-02       ---------------------t--------------ttcatccaggatcg
A0A2I3SNH6_BAK1-01      ----------------ctacgt--------------tttttaccaccatc
A0A2I3T6V0_BAK1-02      aggaggttttccgcagctacgt--------------tttttaccgccatc
A0A2I3T6V0_BAK1-03      aggaggttttccgcagctacgt--------------tttttaccgccatc
A0A2I3T6V0_BAK1-01      aggaggttttccgcagctacgt--------------tttttaccgccatc
                                                                          

H2REG3_BOK-01           tcctggagc--gcgcccgagcgtg-------ccgcgcc--ggtcccggga
A0A2I3TUX1_BAX-03       --------------------------------------------------
A0A2I3TUX1_BAX-01       agcagg-----gcgaatgaggggggaggcacccgagct--ggccctggac
A0A2I3TUX1_BAX-02       agcagg-----gcgaatgaggggggaggcacccgagct--ggccctggac
A0A2I3SNH6_BAK1-01      agcaggaacaggaggctgaaggggcggccgcccctgcc--aacccagaga
A0A2I3T6V0_BAK1-02      agcagaacc---------------------cctctgccatgagcca----
A0A2I3T6V0_BAK1-03      agcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagaga
A0A2I3T6V0_BAK1-01      agcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagaga
                                                                          

H2REG3_BOK-01           cgcctggctgaggtgtgc------gcggtgctgctgcgc--ctgggcgat
A0A2I3TUX1_BAX-03       --------------------------------------------------
A0A2I3TUX1_BAX-01       ccggtgcctca-----------ggatgcgtccaccaagaagctgagcgag
A0A2I3TUX1_BAX-02       ccggtgcctca-----------ggatgcgtccaccaagaagctgagcgag
A0A2I3SNH6_BAK1-01      tggtcaccttgcccctccaacctagcagcaccatggggcaggtgggacgg
A0A2I3T6V0_BAK1-02      ----------------------------------gggcctggtgggacgg
A0A2I3T6V0_BAK1-03      tggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacgg
A0A2I3T6V0_BAK1-01      tggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacgg
                                                                          

H2REG3_BOK-01           gagctggagatgatccggcccagcgtctaccgcaac-gtggcgcgtcagc
A0A2I3TUX1_BAX-03       ------------------------------------------------gc
A0A2I3TUX1_BAX-01       tgtctcaagcgcatcggggacgaactggacagtaac-------atggagc
A0A2I3TUX1_BAX-02       tgtctcaagcgcatcggggacgaactggacagtaac-------atggagc
A0A2I3SNH6_BAK1-01      cagctcgccatcacc-aggatgacatcaaccggcactatgacttcggagt
A0A2I3T6V0_BAK1-02      cagctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagt
A0A2I3T6V0_BAK1-03      cagctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagt
A0A2I3T6V0_BAK1-01      cagctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagt
                                                                        * 

H2REG3_BOK-01           tgcacatc---------tccctgcagtctgagcctgtggtgaccgatgc-
A0A2I3TUX1_BAX-03       ttcaggggatgat--------tgccgccgtggacacagactccccccgag
A0A2I3TUX1_BAX-01       tgcagaggatgat--------tgccgccgtggacacagactccccccgag
A0A2I3TUX1_BAX-02       tgcagaggatgat--------tgccgccgtggacacagactccccccgag
A0A2I3SNH6_BAK1-01      tccagaccatgctgcagcacctgcagcccacggcagagaacgcctacga-
A0A2I3T6V0_BAK1-02      tccagaccatgttgcagcacctgcagcccacggcagagaatgcctatga-
A0A2I3T6V0_BAK1-03      tccagaccatgttgcagcacctgcagcccacggcagagaatgcctatga-
A0A2I3T6V0_BAK1-01      tccagaccatgttgcagcacctgcagcccacggcagagaatgcctatga-
                        * **                 *** * *   * *   *    **   *  

H2REG3_BOK-01           --gttcctggccg---tggctgg--------------------ccacatc
A0A2I3TUX1_BAX-03       aggtctttttccgag-tggcagc--------------------tgacatg
A0A2I3TUX1_BAX-01       aggtctttttccgag-tggcagc--------------------tgacatg
A0A2I3TUX1_BAX-02       aggtctttttccgag-tggcagc--------------------tgacatg
A0A2I3SNH6_BAK1-01      --gtacttcaccaagatcgcctc--------------------cagcctg
A0A2I3T6V0_BAK1-02      --gtacttcaccaagattgccac--------------------cagcctg
A0A2I3T6V0_BAK1-03      --gtacttcaccaagattgccaccaggccagcagcaacacccacagcctg
A0A2I3T6V0_BAK1-01      --gtacttcaccaagattgccac--------------------cagcctg
                          **   *  **    * **                          * * 

H2REG3_BOK-01           ttctctgcagg---catcacgtggggcaaggtggt-gtccctgtatgcgg
A0A2I3TUX1_BAX-03       ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactt
A0A2I3TUX1_BAX-01       ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactt
A0A2I3TUX1_BAX-02       ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactt
A0A2I3SNH6_BAK1-01      tt---tgagagtggcatcaaccagggccgtgtggtggctctcctgggctt
A0A2I3T6V0_BAK1-02      tt---tgagagtggcatcaactggggccgtgtggtggctcttctgggctt
A0A2I3T6V0_BAK1-03      tt---tgagagtggcatcaactggggccgtgtggtggctcttctgggctt
A0A2I3T6V0_BAK1-01      tt---tgagagtggcatcaactggggccgtgtggtggctcttctgggctt
                        **   **   *   * ***    ****   ** ** *  *   *   *  

H2REG3_BOK-01           tggccgcggggctggccgtggactgtgtgaggcaggcccagcctgccatg
A0A2I3TUX1_BAX-03       tgccagc-aaactggtgct---------caag------------------
A0A2I3TUX1_BAX-01       tgccagc-aaactggtgct---------caag------------------
A0A2I3TUX1_BAX-02       tgccagc-aaactggtgct---------caag------------------
A0A2I3SNH6_BAK1-01      cggctac-cgtctggtcctacatgtctaccagcacagcttgactggcttc
A0A2I3T6V0_BAK1-02      cggctac-cgtctggccctacacgtctaccagcatggcctgactggcttc
A0A2I3T6V0_BAK1-03      cggctac-cgtctggccctacacgtctaccagcatggcctga--------
A0A2I3T6V0_BAK1-01      cggctac-cgtctggccctacacgtctaccagcatggcctgactggcttc
                         * *  *    ****   *            *                  

H2REG3_BOK-01           gtccacgccctcgtggactgcctgggggagttcgtgcgcaagaccctggc
A0A2I3TUX1_BAX-03       --------------------------------------------------
A0A2I3TUX1_BAX-01       --------------------------------------------------
A0A2I3TUX1_BAX-02       --------------------------------------------------
A0A2I3SNH6_BAK1-01      ctgggcctggtgacccgcttcgtggt---cttcatgctgcaacacggcat
A0A2I3T6V0_BAK1-02      ctgggccaggtgacccgcttcgtggtcgacttcatgctgcatcactgcat
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      ctgggccaggtgacccgcttcgtggtcgacttcatgctgcatcactgcat
                                                                          

H2REG3_BOK-01           aacc---tggcttcggagacgcggcggatggacggatgtcctcaagtgtg
A0A2I3TUX1_BAX-03       --------------------------------------------------
A0A2I3TUX1_BAX-01       --------------------------------------------------
A0A2I3TUX1_BAX-02       --------------------------------------------------
A0A2I3SNH6_BAK1-01      cacccagtggatctcgcagaggggcggctgggtggcagccctgga-----
A0A2I3T6V0_BAK1-02      tgcccggtggattgcacagaggggtggctgggtggcagccctgaa-----
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      tgcccggtggattgcacagaggggtggctgggtggcagccctgaa-----
                                                                          

H2REG3_BOK-01           tggtcagcacagacccctggcctccctcccactggctggtagct----gc
A0A2I3TUX1_BAX-03       --------------------------------------------------
A0A2I3TUX1_BAX-01       --------------------------------------------------
A0A2I3TUX1_BAX-02       --------------------------------------------------
A0A2I3SNH6_BAK1-01      -------cttgggcaatagtcccatcctgaacgtgctggtggttgtgggt
A0A2I3T6V0_BAK1-02      -------cttgggcaatggtcccatcctgaacgtgctggtagttctgggt
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      -------cttgggcaatggtcccatcctgaacgtgctggtagttctgggt
                                                                          

H2REG3_BOK-01           actctgcagcttcggccgcttcctgaaggctgccttcttcgtc-----
A0A2I3TUX1_BAX-03       ------------------------------------------------
A0A2I3TUX1_BAX-01       ------------------------------------------------
A0A2I3TUX1_BAX-02       ------------------------------------------------
A0A2I3SNH6_BAK1-01      gtggttctgctgggccagtttgtggtaagaagattcttcaaatcatga
A0A2I3T6V0_BAK1-02      gtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
A0A2I3T6V0_BAK1-03      ------------------------------------------------
A0A2I3T6V0_BAK1-01      gtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
                                                                        

© 1998-2018