Dataset for CDS BAX of Organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3TUX1_BAX-03      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I3TUX1_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2I3TUX1_BAX-02      atggacgggtccggggagca------------------------------
                       ********************                              

A0A2I3TUX1_BAX-03      gcagatcatgaagacaggggccctttt-----------------------
A0A2I3TUX1_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2I3TUX1_BAX-02      ------------------------------------tttcatccaggatc
                                                                         

A0A2I3TUX1_BAX-03      --------------------------------------------------
A0A2I3TUX1_BAX-01      gagcagggcgaatgaggggggaggcacccgagctggccctggacccggtg
A0A2I3TUX1_BAX-02      gagcagggcgaatgaggggggaggcacccgagctggccctggacccggtg
                                                                         

A0A2I3TUX1_BAX-03      --------------------------------------------------
A0A2I3TUX1_BAX-01      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2I3TUX1_BAX-02      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
                                                                         

A0A2I3TUX1_BAX-03      ------------------------gcttcaggggatgattgccgccgtgg
A0A2I3TUX1_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2I3TUX1_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
                                               *** *** ******************

A0A2I3TUX1_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I3TUX1_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2I3TUX1_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2I3TUX1_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I3TUX1_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2I3TUX1_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
                       **************************************************

A0A2I3TUX1_BAX-03      cagcaaactggtgctcaag
A0A2I3TUX1_BAX-01      cagcaaactggtgctcaag
A0A2I3TUX1_BAX-02      cagcaaactggtgctcaag
                       *******************

© 1998-2018