Dataset for CDS BAK1 of Organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3SNH6_BAK1-01      atggcatcggggcaaggcccagggcctcccaggcaggagtgcggaaagcc
A0A2I3T6V0_BAK1-02      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
A0A2I3T6V0_BAK1-03      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
A0A2I3T6V0_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
                        ***** ***************** ********************* ****

A0A2I3SNH6_BAK1-01      tgccctgccctctgcttctgagga--------------------------
A0A2I3T6V0_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
A0A2I3T6V0_BAK1-03      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
A0A2I3T6V0_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg

A0A2I3SNH6_BAK1-01      ----------ctacgttttttaccaccatcagcaggaacaggaggctgaa
A0A2I3T6V0_BAK1-02      ttttccgcagctacgttttttaccgccatcagcagaacc-----------
A0A2I3T6V0_BAK1-03      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2I3T6V0_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                                  ************** ********** * *           

A0A2I3SNH6_BAK1-01      ggggcggccgcccctgcc--aacccagagatggtcaccttgcccctccaa
A0A2I3T6V0_BAK1-02      ----------cctctgccatgagcca------------------------
A0A2I3T6V0_BAK1-03      ggggcggctgcccctgcc--gacccagagatggtcaccttacctctgcaa
A0A2I3T6V0_BAK1-01      ggggcggctgcccctgcc--gacccagagatggtcaccttacctctgcaa
                                  ** *****   * ***                        

A0A2I3SNH6_BAK1-01      cctagcagcaccatggggcaggtgggacggcagctcgccatcacc-agga
A0A2I3T6V0_BAK1-02      --------------gggcctggtgggacggcagctcgccatcatcgggga
A0A2I3T6V0_BAK1-03      cctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggga
A0A2I3T6V0_BAK1-01      cctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggga
                                      *** * *********************** *  ***

A0A2I3SNH6_BAK1-01      tgacatcaaccggcactatgacttcggagttccagaccatgctgcagcac
A0A2I3T6V0_BAK1-02      cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
A0A2I3T6V0_BAK1-03      cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
A0A2I3T6V0_BAK1-01      cgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagcac
                         *********** * ******* ** *************** ********

A0A2I3SNH6_BAK1-01      ctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctc
A0A2I3T6V0_BAK1-02      ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
A0A2I3T6V0_BAK1-03      ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
A0A2I3T6V0_BAK1-01      ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccac
                        ******************** ***** ***************** *** *

A0A2I3SNH6_BAK1-01      --------------------cagcctgtttgagagtggcatcaaccaggg
A0A2I3T6V0_BAK1-02      --------------------cagcctgtttgagagtggcatcaactgggg
A0A2I3T6V0_BAK1-03      caggccagcagcaacacccacagcctgtttgagagtggcatcaactgggg
A0A2I3T6V0_BAK1-01      --------------------cagcctgtttgagagtggcatcaactgggg
                                            *************************  ***

A0A2I3SNH6_BAK1-01      ccgtgtggtggctctcctgggcttcggctaccgtctggtcctacatgtct
A0A2I3T6V0_BAK1-02      ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtct
A0A2I3T6V0_BAK1-03      ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtct
A0A2I3T6V0_BAK1-01      ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtct
                        *************** ********************** ****** ****

A0A2I3SNH6_BAK1-01      accagcacagcttgactggcttcctgggcctggtgacccgcttcgtggt-
A0A2I3T6V0_BAK1-02      accagcatggcctgactggcttcctgggccaggtgacccgcttcgtggtc
A0A2I3T6V0_BAK1-03      accagcatggcctga-----------------------------------
A0A2I3T6V0_BAK1-01      accagcatggcctgactggcttcctgggccaggtgacccgcttcgtggtc
                        *******  ** ***                                   

A0A2I3SNH6_BAK1-01      --cttcatgctgcaacacggcatcacccagtggatctcgcagaggggcgg
A0A2I3T6V0_BAK1-02      gacttcatgctgcatcactgcattgcccggtggattgcacagaggggtgg
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      gacttcatgctgcatcactgcattgcccggtggattgcacagaggggtgg

A0A2I3SNH6_BAK1-01      ctgggtggcagccctggacttgggcaatagtcccatcctgaacgtgctgg
A0A2I3T6V0_BAK1-02      ctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      ctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctgg

A0A2I3SNH6_BAK1-01      tggttgtgggtgtggttctgctgggccagtttgtggtaagaagattcttc
A0A2I3T6V0_BAK1-02      tagttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc
A0A2I3T6V0_BAK1-03      --------------------------------------------------
A0A2I3T6V0_BAK1-01      tagttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc

A0A2I3SNH6_BAK1-01      aaatcatga
A0A2I3T6V0_BAK1-02      aaatcatga
A0A2I3T6V0_BAK1-03      ---------
A0A2I3T6V0_BAK1-01      aaatcatga

© 1998-2019