Dataset for CDS BAX-like of Organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R9CGU2_BOK-01       atgga-ggtgctgcggcgctcctcgg-tcttcgccgccgagatcatggac
A0A2R9BX16_BAX-05       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2R9BX16_BAX-01       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2R9BX16_BAX-04       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2R9BX16_BAX-03       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2R9BX16_BAX-02       atggacgggtccggggagcagcccag--------aggcggggg-------
A0A2R8ZTH2_BAK1-01      ----atggcatcagggcaaggcccagggcctcccaggcaggagtgcggaa
A0A2R9A7S4_BAK1-02      ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
A0A2R9A7S4_BAK1-01      ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
A0A2R9A7S4_BAK1-03      ----atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggag
                            * **      **     * * *         * *  *         

A0A2R9CGU2_BOK-01       gcctttgaccgctcgcccacagacaaggagctggtggcccaggcca---a
A0A2R9BX16_BAX-05       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2R9BX16_BAX-01       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2R9BX16_BAX-04       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2R9BX16_BAX-03       ----------tgag---------------g------atcgagca------
A0A2R9BX16_BAX-02       ----------agtg-ac--accccgttctg------attctgcaccctca
A0A2R8ZTH2_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacatgga
A0A2R9A7S4_BAK1-02      agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacaga
A0A2R9A7S4_BAK1-01      agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacaga
A0A2R9A7S4_BAK1-03      agcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacaga
                                                     *           *        

A0A2R9CGU2_BOK-01       ggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctct
A0A2R9BX16_BAX-05       ggcccttttgc----ttcag-------------ggtttcatccaggatcg
A0A2R9BX16_BAX-01       ggcccttttgc----ttcag-------------ggtttcatccaggatcg
A0A2R9BX16_BAX-04       ggcccttttgc----ttcag-------------g----------------
A0A2R9BX16_BAX-03       -------------------g-------------g----------------
A0A2R9BX16_BAX-02       ctccatcccca----ctcta-------------g----------------
A0A2R8ZTH2_BAK1-01      gg-ggttttccgcagctacg-------------tttttttaccaccatca
A0A2R9A7S4_BAK1-02      ggaggttttccgcagctacg--------------ttttttaccgccatca
A0A2R9A7S4_BAK1-01      ggaggttttccgcagctacg--------------ttttttaccgccatca
A0A2R9A7S4_BAK1-03      ggaggttttccgcagctacg--------------ttttttaccgccatca
                                                                          

A0A2R9CGU2_BOK-01       cctggagc--------------gcgcccgagcgtgcc--------gcgcc
A0A2R9BX16_BAX-05       agcagggcgaatggggggggaggcacccgagctggcc-----------ct
A0A2R9BX16_BAX-01       agcagggcgaatggggggggaggcacccgagctggcc-----------ct
A0A2R9BX16_BAX-04       --------------------------------------------------
A0A2R9BX16_BAX-03       ------gcgaatggggggggaggcacccgagctggcc-----------ct
A0A2R9BX16_BAX-02       ------gcgaatggggggggaggcacccgagctggcc-----------ct
A0A2R8ZTH2_BAK1-01      gcaggaacaggaggctgaaggggcggccgcccctgcc--aacccagagat
A0A2R9A7S4_BAK1-02      gcagaacc---------------------cctctgccatgagcca-----
A0A2R9A7S4_BAK1-01      gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
A0A2R9A7S4_BAK1-03      gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
                                                                          

A0A2R9CGU2_BOK-01       ggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcg
A0A2R9BX16_BAX-05       ggacccggtgcctcag---gatgcgtccacca------agaagctgagcg
A0A2R9BX16_BAX-01       ggacccggtgcctcag---gatgcgtccacca------agaagctgagcg
A0A2R9BX16_BAX-04       --------------------------------------------------
A0A2R9BX16_BAX-03       ggacccggtgcctcag---gatgcgtccacca------agaagctgagcg
A0A2R9BX16_BAX-02       ggacccggtgcctcag---gatgcgtccacca------agaagctgagcg
A0A2R8ZTH2_BAK1-01      ggtcaccttgcccctc---caacctagcagcaccatggggcaggtgggac
A0A2R9A7S4_BAK1-02      ------------------------------------gggcctggtgggac
A0A2R9A7S4_BAK1-01      ggtcaccttacctctg---caacctagcagcaccatggggcaggtgggac
A0A2R9A7S4_BAK1-03      ggtcaccttacctctg---caacctagcagcaccatggggcaggtgggac
                                                                          

A0A2R9CGU2_BOK-01       atgagctggagatgatccggcccagcgtctaccg------caac-gtggc
A0A2R9BX16_BAX-05       agtgtctcaagcgcatcggggacgaactggacag------taac-atgga
A0A2R9BX16_BAX-01       agtgtctcaagcgcatcggggacgaactggacag------taac-atgga
A0A2R9BX16_BAX-04       --------------------------------------------------
A0A2R9BX16_BAX-03       agtgtctcaagcgcatcggggacgaactggacag------taac-atgga
A0A2R9BX16_BAX-02       agtgtctcaagcgcatcggggacgaactggacag------taac-atgga
A0A2R8ZTH2_BAK1-01      ggcagctcgccatcacc-aggacgacatcaaccggcactatgacttcgga
A0A2R9A7S4_BAK1-02      ggcagctcgccatcatcggggacgacatcaaccgacgctatgac-tcaga
A0A2R9A7S4_BAK1-01      ggcagctcgccatcatcggggacgacatcaaccgacgctatgac-tcaga
A0A2R9A7S4_BAK1-03      ggcagctcgccatcatcggggacgacatcaaccgacgctatgac-tcaga
                                                                          

A0A2R9CGU2_BOK-01       gcgtcagc---tgcacatctccctgcagtctgagcctgtggtgaccgatg
A0A2R9BX16_BAX-05       gctgcagaggatgat--------tgccgccgtggacacagactccccccg
A0A2R9BX16_BAX-01       gctgcagaggatgat--------tgccgccgtggacacagactccccccg
A0A2R9BX16_BAX-04       --------ggatgat--------tgccgccgtggacacagactccccccg
A0A2R9BX16_BAX-03       gctgcagaggatgat--------tgccgccgtggacacagactccccccg
A0A2R9BX16_BAX-02       gctgcagaggatgat--------tgccgccgtggacacagactccccccg
A0A2R8ZTH2_BAK1-01      gttccagaccatgctgcagcacctgcagcccacggcagagaacgcctacg
A0A2R9A7S4_BAK1-02      gttccagaccatgttgcagcacctgcagcccacggcagagaatgcctatg
A0A2R9A7S4_BAK1-01      gttccagaccatgttgcagcacctgcagcccacggcagagaatgcctatg
A0A2R9A7S4_BAK1-03      gttccagaccatgttgcagcacctgcagcccacggcagagaatgcctatg
                                   **          *** * *   * *   *    **   *

A0A2R9CGU2_BOK-01       c---gttcctggccg---tggctgg--------------------ccaca
A0A2R9BX16_BAX-05       agaggtctttttccgag-tggcagc--------------------tgaca
A0A2R9BX16_BAX-01       agaggtctttttccgag-tggcagc--------------------tgaca
A0A2R9BX16_BAX-04       agaggtctttttccgag-tggcagc--------------------tgaca
A0A2R9BX16_BAX-03       agaggtctttttccgag-tggcagc--------------------tgaca
A0A2R9BX16_BAX-02       agaggtctttttccgag-tggcagc--------------------tgaca
A0A2R8ZTH2_BAK1-01      a---gtacttcaccaagatcgcctc--------------------cagcc
A0A2R9A7S4_BAK1-02      a---gtacttcaccaagattgccac--------------------cagcc
A0A2R9A7S4_BAK1-01      a---gtacttcaccaagattgccac--------------------cagcc
A0A2R9A7S4_BAK1-03      a---gtacttcaccaagattgccaccaggccagcagcaacacccacagcc
                            **   *  **    * **                          * 

A0A2R9CGU2_BOK-01       tcttctctgcagg---catcacgtggggcaaggtggt-gtccctgtatgc
A0A2R9BX16_BAX-05       tgttttctgacggcaacttcaactggggccgggttgtcgcccttttctac
A0A2R9BX16_BAX-01       tgttttctgacggcaacttcaactggggccgggttgtcgcccttttctac
A0A2R9BX16_BAX-04       tgttttctgacggcaacttcaactggggccgggttgtcgcccttttctac
A0A2R9BX16_BAX-03       tgttttctgacggcaacttcaactggggccgggttgtcgcccttttctac
A0A2R9BX16_BAX-02       tgttttctgacggcaacttcaactggggccgggttgtcgcccttttctac
A0A2R8ZTH2_BAK1-01      tgtt---tgagagtggcatcaaccggggccgtgtggtggctctcctgggc
A0A2R9A7S4_BAK1-02      tgtt---tgagagtggcatcaactggggccgtgtggtggctcttctgggc
A0A2R9A7S4_BAK1-01      tgtt---tgagagtggcatcaactggggccgtgtggtggctcttctgggc
A0A2R9A7S4_BAK1-03      tgtt---tgagagtggcatcaactggggccgtgtggtggctcttctgggc
                        * **   **   *   * ***   *****   ** ** *  *   *   *

A0A2R9CGU2_BOK-01       ggtggccgcggggctggccgt----ggactgtgtgaggcaggcccagcct
A0A2R9BX16_BAX-05       tttgccagc-aaactggtgctcaaggccctgtgca--------ccaaggt
A0A2R9BX16_BAX-01       tttgccagc-aaactggtgctcaaggccctgtgca--------ccaaggt
A0A2R9BX16_BAX-04       tttgccagc-aaactggtgctcaaggccctgtgca--------ccaaggt
A0A2R9BX16_BAX-03       tttgccagc-aaactggtgctcaaggccctgtgca--------ccaaggt
A0A2R9BX16_BAX-02       tttgccagc-aaactggtgctcaaggccctgtgca--------ccaaggt
A0A2R8ZTH2_BAK1-01      ttcggctac-cgtctggtcct-----acatgtcta--------ccagcat
A0A2R9A7S4_BAK1-02      ttcggctac-cgtctggccct-----acacgtcta--------ccagcat
A0A2R9A7S4_BAK1-01      ttcggctac-cgtctggccct-----acacgtcta--------ccagcat
A0A2R9A7S4_BAK1-03      ttcggctac-cgtctggccct-----acacgtcta--------ccagcat
                           * *  *    ****   *         **           ***   *

A0A2R9CGU2_BOK-01       gcca----tggtccacgccctcgtggactgcctgggggagttcgtgcgca
A0A2R9BX16_BAX-05       gccggaactgatcagaaccatcatgggctggacattggacttcctccggg
A0A2R9BX16_BAX-01       gccggaactgatcagaaccatcatgggctggacattggacttcctccggg
A0A2R9BX16_BAX-04       gccggaactgatcagaaccatcatgggctggacattggacttcctccggg
A0A2R9BX16_BAX-03       gccggaactgatcagaaccatcatgggctggacattggacttcctccggg
A0A2R9BX16_BAX-02       gccggaactgatcagaaccatcatgggctggacattggacttcctccggg
A0A2R8ZTH2_BAK1-01      ggcttgactgg-------cttcctgggcctggt----gacccgcttcgtg
A0A2R9A7S4_BAK1-02      ggcctgactgg-------cttcctgggccaggt----gacccgcttcgtg
A0A2R9A7S4_BAK1-01      ggcctgactgg-------cttcctgggccaggt----gacccgcttcgtg
A0A2R9A7S4_BAK1-03      ggcctga-------------------------------------------
                        * *                                               

A0A2R9CGU2_BOK-01       agaccctggcaacctggcttc---ggagacgcggcggatggacggatgtc
A0A2R9BX16_BAX-05       agcggctgttgggctggatc----caagaccagggtggttgggtgagact
A0A2R9BX16_BAX-01       agcggctgttgggctggatc----caagaccagggtggttg---------
A0A2R9BX16_BAX-04       agcggctgttgggctggatc----caagaccagggtggttg---------
A0A2R9BX16_BAX-03       agcggctgttgggctggatc----caagaccagggtggttgggggctgcc
A0A2R9BX16_BAX-02       agcggctgttgggctggatc----caagaccagggtggttgggggctgcc
A0A2R8ZTH2_BAK1-01      gt---ct-tcatgctgcaacacggcatcgcccagtggatct---------
A0A2R9A7S4_BAK1-02      gtcgact-tcatgctgcatcactgcattgcccggtggattg---------
A0A2R9A7S4_BAK1-01      gtcgact-tcatgctgcatcactgcattgcccggtggattg---------
A0A2R9A7S4_BAK1-03      --------------------------------------------------
                                                                          

A0A2R9CGU2_BOK-01       ctcaagtgtgtggtcagcacagaccct-----------------ggcctc
A0A2R9BX16_BAX-05       cctca---------------------------------------agcctc
A0A2R9BX16_BAX-01       ----------------------------------------ggacggcctc
A0A2R9BX16_BAX-04       ----------------------------------------ggacggcctc
A0A2R9BX16_BAX-03       cctggccgagtcactgaagcgactgatgtccctgtctccaggacggcctc
A0A2R9BX16_BAX-02       cctggccgagtcactgaagcgactgatgtccctgtctccaggacggcctc
A0A2R8ZTH2_BAK1-01      --------------------------------------------------
A0A2R9A7S4_BAK1-02      --------------------------------------------------
A0A2R9A7S4_BAK1-01      --------------------------------------------------
A0A2R9A7S4_BAK1-03      --------------------------------------------------
                                                                          

A0A2R9CGU2_BOK-01       cgctcccactggctggtagctgcactctgcagcttcgg----ccgcttcc
A0A2R9BX16_BAX-05       ctcacccccaccaccgcgccctca--ccactgcccctgccccaccgtccc
A0A2R9BX16_BAX-01       ctctcctactttgggacgcccacg--tggcagaccgtg----accatctt
A0A2R9BX16_BAX-04       ctctcctactttgggacgcccacg--tggcagaccgtg----accatctt
A0A2R9BX16_BAX-03       ctctcctactttgggacgcccacg--tggcagaccgtg----accatctt
A0A2R9BX16_BAX-02       ctctcctactttgggacgcccacg--tggcagaccgtg----accatctt
A0A2R8ZTH2_BAK1-01      ------cgcagaggggcggctggg--tggcagccctgg---------act
A0A2R9A7S4_BAK1-02      ------cacagaggggtggctggg--tggcagccctga---------act
A0A2R9A7S4_BAK1-01      ------cacagaggggtggctggg--tggcagccctga---------act
A0A2R9A7S4_BAK1-03      --------------------------------------------------
                                                                          

A0A2R9CGU2_BOK-01       tgaaggctgccttcttcgtgctgctgccagagag----------------
A0A2R9BX16_BAX-05       -----------tgccccccgccactcctctgggaccctgggccttctgga
A0A2R9BX16_BAX-01       tgtggcgggagtgctcaccgcctcactc------------accatctgga
A0A2R9BX16_BAX-04       tgtggcgggagtgctcaccgcctcactc------------accatctgga
A0A2R9BX16_BAX-03       tgtggcgggagtgctcaccgcctcactc------------accatctgga
A0A2R9BX16_BAX-02       tgtggcgggagtgctcaccgcctcactc------------accatctgga
A0A2R8ZTH2_BAK1-01      tggcaccgccttcaccactgccccatcctgg-------------------
A0A2R9A7S4_BAK1-02      tgg----------gcaatggtcccatcctgaacgtgctggtagttctggg
A0A2R9A7S4_BAK1-01      tgg----------gcaatggtcccatcctgaacgtgctggtagttctggg
A0A2R9A7S4_BAK1-03      --------------------------------------------------
                                                                          

A0A2R9CGU2_BOK-01       --------------------------------------------------
A0A2R9BX16_BAX-05       gcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtc
A0A2R9BX16_BAX-01       agaagatgggctga------------------------------------
A0A2R9BX16_BAX-04       agaagatgggctga------------------------------------
A0A2R9BX16_BAX-03       agaagatgggctgaggccccc---------------------agctgcct
A0A2R9BX16_BAX-02       agaagatgggctgaggccccc---------------------agctgcct
A0A2R8ZTH2_BAK1-01      --------------------------------------------------
A0A2R9A7S4_BAK1-02      tgtggttctgttgggcca------------------------gtttgtgg
A0A2R9A7S4_BAK1-01      tgtggttctgttgggcca------------------------gtttgtgg
A0A2R9A7S4_BAK1-03      --------------------------------------------------
                                                                          

A0A2R9CGU2_BOK-01       -------------------atga----
A0A2R9BX16_BAX-05       tataatgcgttttccttacatgtctga
A0A2R9BX16_BAX-01       ---------------------------
A0A2R9BX16_BAX-04       ---------------------------
A0A2R9BX16_BAX-03       tggactgtgtttttcctccataa----
A0A2R9BX16_BAX-02       tggactgtgtttttcctccataa----
A0A2R8ZTH2_BAK1-01      -------------------ctga----
A0A2R9A7S4_BAK1-02      tacgaagattcttcaaatcatga----
A0A2R9A7S4_BAK1-01      tacgaagattcttcaaatcatga----
A0A2R9A7S4_BAK1-03      ---------------------------
                                                   

© 1998-2018