Dataset for CDS BAX of Organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R9BX16_BAX-05      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2R9BX16_BAX-04      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2R9BX16_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2R9BX16_BAX-03      atggacgggtccggggagcagcccagaggcgggggtgag-----------
A0A2R9BX16_BAX-02      atggacgggtccggggagcagcccagaggcgggggagtgac--accccgt

A0A2R9BX16_BAX-05      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2R9BX16_BAX-04      gcagatcatgaagacaggggcccttttgcttcagg---------------
A0A2R9BX16_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2R9BX16_BAX-03      ---gatcgagca---------------------gg---------------
A0A2R9BX16_BAX-02      tctgattctgcaccctcactccatccccactctag---------------
                          ***   * *                      *               

A0A2R9BX16_BAX-05      gagcagggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2R9BX16_BAX-04      --------------------------------------------------
A0A2R9BX16_BAX-01      gagcagggcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2R9BX16_BAX-03      -------gcgaatggggggggaggcacccgagctggccctggacccggtg
A0A2R9BX16_BAX-02      -------gcgaatggggggggaggcacccgagctggccctggacccggtg

A0A2R9BX16_BAX-05      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2R9BX16_BAX-04      --------------------------------------------------
A0A2R9BX16_BAX-01      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2R9BX16_BAX-03      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2R9BX16_BAX-02      cctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg

A0A2R9BX16_BAX-05      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2R9BX16_BAX-04      --------------------------------ggatgattgccgccgtgg
A0A2R9BX16_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2R9BX16_BAX-03      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2R9BX16_BAX-02      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg

A0A2R9BX16_BAX-05      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2R9BX16_BAX-04      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2R9BX16_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2R9BX16_BAX-03      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2R9BX16_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt

A0A2R9BX16_BAX-05      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2R9BX16_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2R9BX16_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2R9BX16_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2R9BX16_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc

A0A2R9BX16_BAX-05      cagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
A0A2R9BX16_BAX-04      cagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
A0A2R9BX16_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
A0A2R9BX16_BAX-03      cagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
A0A2R9BX16_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca

A0A2R9BX16_BAX-05      gaaccatcatgggctggacattggacttcctccgggagcggctgttgggc
A0A2R9BX16_BAX-04      gaaccatcatgggctggacattggacttcctccgggagcggctgttgggc
A0A2R9BX16_BAX-01      gaaccatcatgggctggacattggacttcctccgggagcggctgttgggc
A0A2R9BX16_BAX-03      gaaccatcatgggctggacattggacttcctccgggagcggctgttgggc
A0A2R9BX16_BAX-02      gaaccatcatgggctggacattggacttcctccgggagcggctgttgggc

A0A2R9BX16_BAX-05      tggatccaagaccagggtggttgggtgagactcctca-------------
A0A2R9BX16_BAX-04      tggatccaagaccagggtggttg---------------------------
A0A2R9BX16_BAX-01      tggatccaagaccagggtggttg---------------------------
A0A2R9BX16_BAX-03      tggatccaagaccagggtggttgggggctgcccctggccgagtcactgaa
A0A2R9BX16_BAX-02      tggatccaagaccagggtggttgggggctgcccctggccgagtcactgaa

A0A2R9BX16_BAX-05      --------------------------agcctcctcacccccaccaccgcg
A0A2R9BX16_BAX-04      ----------------------ggacggcctcctctcctactttgggacg
A0A2R9BX16_BAX-01      ----------------------ggacggcctcctctcctactttgggacg
A0A2R9BX16_BAX-03      gcgactgatgtccctgtctccaggacggcctcctctcctactttgggacg
A0A2R9BX16_BAX-02      gcgactgatgtccctgtctccaggacggcctcctctcctactttgggacg
                                                  ******** **  *       **

A0A2R9BX16_BAX-05      ccctcaccactgcccctgccccaccgtccc-----------tgccccccg
A0A2R9BX16_BAX-04      cccacgtggcagaccgtg----accatctttgtggcgggagtgctcaccg
A0A2R9BX16_BAX-01      cccacgtggcagaccgtg----accatctttgtggcgggagtgctcaccg
A0A2R9BX16_BAX-03      cccacgtggcagaccgtg----accatctttgtggcgggagtgctcaccg
A0A2R9BX16_BAX-02      cccacgtggcagaccgtg----accatctttgtggcgggagtgctcaccg
                       *** *    * * ** **    *** **             *** * ***

A0A2R9BX16_BAX-05      ccactcctctgggaccctgggccttctggagcaggtcacagtggtgccct
A0A2R9BX16_BAX-04      cctcactc------------accatctggaagaagatgggctga------
A0A2R9BX16_BAX-01      cctcactc------------accatctggaagaagatgggctga------
A0A2R9BX16_BAX-03      cctcactc------------accatctggaagaagatgggctgaggcccc
A0A2R9BX16_BAX-02      cctcactc------------accatctggaagaagatgggctgaggcccc
                       ** * *               ** ******  * *      **       

A0A2R9BX16_BAX-05      ctccccatcttcagatcatcagatgtggtctataatgcgttttccttaca
A0A2R9BX16_BAX-04      --------------------------------------------------
A0A2R9BX16_BAX-01      --------------------------------------------------
A0A2R9BX16_BAX-03      c---------------------agctgccttggactgtgtttttcctcca
A0A2R9BX16_BAX-02      c---------------------agctgccttggactgtgtttttcctcca

A0A2R9BX16_BAX-05      tgtctga
A0A2R9BX16_BAX-04      -------
A0A2R9BX16_BAX-01      -------
A0A2R9BX16_BAX-03      taa----
A0A2R9BX16_BAX-02      taa----

© 1998-2019