Dataset for CDS BAK1 of Organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8ZTH2_BAK1-01      atggcatcagggcaaggcccagggcctcccaggcaggagtgcggaaagcc
A0A2R9A7S4_BAK1-02      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
A0A2R9A7S4_BAK1-01      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
A0A2R9A7S4_BAK1-03      atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcc
                        ***** ** ************** ********************* ****

A0A2R8ZTH2_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccaggacatggagg-gg
A0A2R9A7S4_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
A0A2R9A7S4_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
A0A2R9A7S4_BAK1-03      tgccctgccctctgcttctgaggagcaggtagcccaggacacagaggagg
                        *****************************************  **** **

A0A2R8ZTH2_BAK1-01      ttttccgcagctacgtttttttaccaccatcagcaggaacaggaggctga
A0A2R9A7S4_BAK1-02      ttttccgcagctacg-ttttttaccgccatcagcagaacc----------
A0A2R9A7S4_BAK1-01      ttttccgcagctacg-ttttttaccgccatcagcaggaacaggaggctga
A0A2R9A7S4_BAK1-03      ttttccgcagctacg-ttttttaccgccatcagcaggaacaggaggctga
                        *************** ********* ********** * *          

A0A2R8ZTH2_BAK1-01      aggggcggccgcccctgcc--aacccagagatggtcaccttgcccctcca
A0A2R9A7S4_BAK1-02      -----------cctctgccatgagcca-----------------------
A0A2R9A7S4_BAK1-01      aggggcggctgcccctgcc--gacccagagatggtcaccttacctctgca
A0A2R9A7S4_BAK1-03      aggggcggctgcccctgcc--gacccagagatggtcaccttacctctgca
                                   ** *****   * ***                       

A0A2R8ZTH2_BAK1-01      acctagcagcaccatggggcaggtgggacggcagctcgccatcacc-agg
A0A2R9A7S4_BAK1-02      ---------------gggcctggtgggacggcagctcgccatcatcgggg
A0A2R9A7S4_BAK1-01      acctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggg
A0A2R9A7S4_BAK1-03      acctagcagcaccatggggcaggtgggacggcagctcgccatcatcgggg
                                       *** * *********************** *  **

A0A2R8ZTH2_BAK1-01      acgacatcaaccggcactatgacttcggagttccagaccatgctgcagca
A0A2R9A7S4_BAK1-02      acgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagca
A0A2R9A7S4_BAK1-01      acgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagca
A0A2R9A7S4_BAK1-03      acgacatcaaccgacgctatgac-tcagagttccagaccatgttgcagca
                        ************* * ******* ** *************** *******

A0A2R8ZTH2_BAK1-01      cctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcct
A0A2R9A7S4_BAK1-02      cctgcagcccacggcagagaatgcctatgagtacttcaccaagattgcca
A0A2R9A7S4_BAK1-01      cctgcagcccacggcagagaatgcctatgagtacttcaccaagattgcca
A0A2R9A7S4_BAK1-03      cctgcagcccacggcagagaatgcctatgagtacttcaccaagattgcca
                        ********************* ***** ***************** *** 

A0A2R8ZTH2_BAK1-01      c--------------------cagcctgtttgagagtggcatcaaccggg
A0A2R9A7S4_BAK1-02      c--------------------cagcctgtttgagagtggcatcaactggg
A0A2R9A7S4_BAK1-01      c--------------------cagcctgtttgagagtggcatcaactggg
A0A2R9A7S4_BAK1-03      ccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggg
                        *                    ************************* ***

A0A2R8ZTH2_BAK1-01      gccgtgtggtggctctcctgggcttcggctaccgtctggtcctacatgtc
A0A2R9A7S4_BAK1-02      gccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtc
A0A2R9A7S4_BAK1-01      gccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtc
A0A2R9A7S4_BAK1-03      gccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtc
                        **************** ********************** ****** ***

A0A2R8ZTH2_BAK1-01      taccagcatggcttgactggcttcctgggcctggtgacccgcttcgtggt
A0A2R9A7S4_BAK1-02      taccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggt
A0A2R9A7S4_BAK1-01      taccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggt
A0A2R9A7S4_BAK1-03      taccagcatggcctga----------------------------------
                        ************ ***                                  

A0A2R8ZTH2_BAK1-01      ---cttcatgctgcaacacggcatcgcccagtggatctcgcagaggggcg
A0A2R9A7S4_BAK1-02      cgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtg
A0A2R9A7S4_BAK1-01      cgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtg
A0A2R9A7S4_BAK1-03      --------------------------------------------------

A0A2R8ZTH2_BAK1-01      gctgggtggcagccctggacttggcaccgccttcaccactgccccatcct
A0A2R9A7S4_BAK1-02      gctgggtggcagccctgaacttgg----------gcaatggtcccatcct
A0A2R9A7S4_BAK1-01      gctgggtggcagccctgaacttgg----------gcaatggtcccatcct
A0A2R9A7S4_BAK1-03      --------------------------------------------------

A0A2R8ZTH2_BAK1-01      gg------------------------------------------------
A0A2R9A7S4_BAK1-02      gaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtac
A0A2R9A7S4_BAK1-01      gaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtac
A0A2R9A7S4_BAK1-03      --------------------------------------------------

A0A2R8ZTH2_BAK1-01      ----------------ctga
A0A2R9A7S4_BAK1-02      gaagattcttcaaatcatga
A0A2R9A7S4_BAK1-01      gaagattcttcaaatcatga
A0A2R9A7S4_BAK1-03      --------------------

© 1998-2019