Dataset for CDS BAX-like of Organism Ovis aries

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5PSA7_BAX-01       -----acccggcgagaggcggtg-------aggcgggaggcagacgggcgggggcccacc
W5PK25_BAK1-01      atggcttcgggacaaggtccaggtccccctgggcagggctgcgatgagcctgaaccctcc
W5Q896_BOK-01       -----ctcggccgcgagttcgtgcac------gcgcggctgctacgcg-ctggcctctcc
                           * *      *     *         **  *      * * *   *  * * **

W5PSA7_BAX-01       agctc-tgagcagatcatgaagacaggg-----------gcccttttgcttcagggtttc
W5PK25_BAK1-01      tccgcatcggaggagcaggtagcccggg-ataccgaggaggtcttccgcagctacgtctt
W5Q896_BOK-01       t----------ggagcg---cgcccgagcgcgccgcgccggtccccggcggccgcct---
                                ** *     * * * *           *  *    **  *    *   

W5PSA7_BAX-01       atccaggatcgagcag-ggcgaatggggggagagacacccgagctg----------ggct
W5PK25_BAK1-01      ttaccgccatcagcaggagcaggaggccgagggggcggctgcgcct-------actgacc
W5Q896_BOK-01       -----------ggcggaggtgtgcgcc-----gtgctgctgcgcctggcagcggacgagc
                                ** *  *     *          *  * * **            *   

W5PSA7_BAX-01       tggagcaggtgccccaggatgca---tccacca----------------------agaag
W5PK25_BAK1-01      cagagatggtcaccttgcacccagagcctacca-gtcctgatcctccagcaccatgggag
W5Q896_BOK-01       tggagctgatcc-----ggcccagcgtctaccgcaacgtggcccgccagc-----tgaac
                      ***  * *           **    * ***                        * * 

W5PSA7_BAX-01       ctgagcgagtgtctgaagcgcattggagatgaattggacag------taacatggagctg
W5PK25_BAK1-01      ctcgcc--gt----------catcggggatgacatcaaccggcgctacgacacagagttc
W5Q896_BOK-01       ctctccttgc----------agtcggagaccgtggtgaccgacgcc-----------ttc
                    **   *  *             * ** **        ** *                 * 

W5PSA7_BAX-01       cagaggatgatc--------gcagccgtggac------acagactctccccgagaggtct
W5PK25_BAK1-01      caggccatgctgcagcacctgcagccga--------cggcagacaacgcctacgagtact
W5Q896_BOK-01       ctggccgtg-----------gcgacccagatcttctctgcaggcatcacgtgggg-----
                    * *    **           **  **             *** *    *    *      

W5PSA7_BAX-01       ttttccgagtggcggctgaaatgt--tttccgacggcaacttcaactggggcc---gggt
W5PK25_BAK1-01      tcaccaagatcgcgtccagcctgt-----ttgagagcggcatcaactggggcc---gcgt
W5Q896_BOK-01       ----caaggttgtgtc---tctgtactcggtggccgcggggctggccggggactgtgtgc
                        *    * * * *     ***       *   **        * **** *   * * 

W5PSA7_BAX-01       tgtcgcccttttc-tactttgccagcaaactggtgctcaa--------ggccctgtgcac
W5PK25_BAK1-01      ggtgg--ctctgc-tgggttacgg----------cttccgcctggccc-tccacgtctac
W5Q896_BOK-01       ggcaggccccggcgtgggacacgggcagctccgtcccctgcctgtcctgtcctcgggc-c
                     *  *  *    * *      *               *            **  *    *

W5PSA7_BAX-01       caaggtgcccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcg
W5PK25_BAK1-01      cagcgcggcctgaccgg-------cttcctgggccaggt----gacccgcttcgtggccg
W5Q896_BOK-01       cggcggggctggacaga-------cgtgctcaagtgtgt----ggtcagc------accg
                    *   * * *      *        * *  *             *     *        **

W5PSA7_BAX-01       gct----gctgggc---------------tggatccaggaccagggtggttgggacggcc
W5PK25_BAK1-01      acttcgtgctgcgtcgctccatcgcccggtggatcgcacagaggggtggctggg------
W5Q896_BOK-01       acccaggcctgcgc-------------------tctcactggctggtggccgcg------
                     *      *** *                    **         *****  * *      

W5PSA7_BAX-01       tcctctcctactttgg--------gacacccacatggcagacggtgaccatctttgtggc
W5PK25_BAK1-01      ----tggcagccctggacttggggaacgcccccat-caagaacgtagccatagttctggc
W5Q896_BOK-01       --ctctgcagctttgg-------------ccgctt-cctgaaggctgcc----ttct--t
                           *  *  ***             ** * *    **  *   **    ** *   

W5PSA7_BAX-01       tggagtgctcactgcctcactcaccatctggaagaagat---gggctga
W5PK25_BAK1-01      tgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
W5Q896_BOK-01       catgctgttgccgg---------------------------agagatga
                         *  *    *                            *   ***

© 1998-2018