Dataset for CDS BAX-like of Organism Otolemur garnettii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H0XDK0_BAK1-01      atggcatccgggcaaggcccag--gtcctcctgggcaggagtgtgga-gagtccacccag
H0XH75_BAX-01       atgga-------cgg---------gtc-------cggggagca-----------------
H0XQN5_BOK-01       atggagatgctgcggcgctcttcagtcctcgccgcggagatcatggatgcctttgaccgc
                    ****        *           ***           **                    

H0XDK0_BAK1-01      ccttccatatctgaggagcaggtagcccgggaca----------caga------------
H0XH75_BAX-01       --gccc-------agaggcggggggccca--cca--gctctgagcaga----tcatgaag
H0XQN5_BOK-01       tcgcccaccgacaaggagctggtggcccaggccaaggcgctgggcagggagttcgtgcac
                        **       **  ** **  ****    **          ***             

H0XDK0_BAK1-01      ---ggaagtcttccgcagctacgttttttaccgccatcagcaggagcaggaggctgaggg
H0XH75_BAX-01       acaggggcccttttgcttcagggtttcatccaggatcgagcag-----ggcgaatggggg
H0XQN5_BOK-01       gctcgg---ctgctgcgcgctggcctcgcctgg--------ag-----cgcgcctgagcg
                        *    **   **      *  *      *        **      * *  ** * *

H0XDK0_BAK1-01      ggcagctgcccctgctgacccagagatggtcaccttgcctctagaacccagcagca-cta
H0XH75_BAX-01       gggagacacctgagctggccctggagccgacgcccca------------ggatgcatcca
H0XQN5_BOK-01       cg-------ctgcgctggtccttg-gcggccgcctgg-----------cagaggtgtgca
                     *       *   ****  **       * * **                *  *     *

H0XDK0_BAK1-01      tggggcaggtgggtcggcagcttgccatcatcggggatgacatcaaccgg----------
H0XH75_BAX-01       ccaagaagctaagcgagtgtctcaaacgcatcggggatg-----aactgg----------
H0XQN5_BOK-01       ctgtgctgct---------------gcgcttgggggatg-----agctggagctgatacg
                        *  * *                  * * *******     * * **          

H0XDK0_BAK1-01      ----------cgctatgactcagagttccagaccatgctgcagcact---tgcagcccac
H0XH75_BAX-01       -----------acagtaacatgg------a------gctgcaga------ggatgattgc
H0XQN5_BOK-01       gcccggtgtctaccgcaacgtggctcgcca------gctgcacatctccctgcagtctga
                                *    **   *      *      ******         *  *     

H0XDK0_BAK1-01      agcagagaacgcctat------------gagtatttcatcaagatcgcctcaagcctgtt
H0XH75_BAX-01       tgctgtggacacagactccccccgtgaggtttttttccgagtggcagctgagatgttttc
H0XQN5_BOK-01       gcctgtggtgaccgac------------gcatttctggctgtggcaggccacatattctc
                      * * *    *  *             *  * * *      *   *     *   * * 

H0XDK0_BAK1-01      tgagagtggcatcaactggggccgtgtggtggctctcctgggtttcggctaccgcctggc
H0XH75_BAX-01       tgatggcaacttcaactggggccgggttgtggccct------------cttctactttgc
H0XQN5_BOK-01       tgcaggca---tcacgtggggcaaggtggtgtccct-gtatgcagtggctgcagggctgg
                    **   *     ***  ******   ** *** * **            ** *      * 

H0XDK0_BAK1-01      cat----ccatgtttacca-gcgcggcctgactggcttcctgggccag--------gtga
H0XH75_BAX-01       aagcaaactg-gtgctcaaggccctgtgcacgaaggtccctgagctgatcagaactatca
H0XQN5_BOK-01       cagtggactgtgtgcggcaggctcagcctgccatggtccatg------------cccttg
                     *     *   **     * ** * *        * * * **               *  

H0XDK0_BAK1-01      ctcgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggatcgcgcagaggg
H0XH75_BAX-01       tgggctggacattggacttcctccgagagcgactgctgggc---tggatccaagaccagg
H0XQN5_BOK-01       ttgactgcttgggggaatttgtgcgcaagaccctggcagcc---tggctgcggaggcgcg
                        **        ** **  * *   *          * *   *** *          *

H0XDK0_BAK1-01      gcggctgggtggcggccctgg-----------acttgggcaacggccccatccgtaatgt
H0XH75_BAX-01       gtggttgggacggcctcct--------ttcctactttggaacc---cctacgtggcagac
H0XQN5_BOK-01       gtggatggacagacgtcctaaagtgtgtggtcagtacggacccaggcctccgctcc---c
                    * ** ***   *    ***             * *  **   *   **            

H0XDK0_BAK1-01      actgatgg---ttctggctgtggttct------gttgggccagtttgtggtacgaagatt
H0XH75_BAX-01       agtgaccatctttgtggctggagtgct-tactgcctcgctcaccatctgg-aagaagat-
H0XQN5_BOK-01       actggc-----ttgtggc---aacgctctgcagcttcggtcgcttcctga-aggctgcct
                    * **       ** ****       **        * *  *      **  * *  *   

H0XDK0_BAK1-01      cttc-------------aagtcatga
H0XH75_BAX-01       -------------------gggctga
H0XQN5_BOK-01       tcttcgtgcttttgccagagagatga
                                       *   ***

© 1998-2018