Dataset for CDS BOK of Organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2L9U3_BOK-02      ttggaaagcatgagg---gcctgtggggttgccagagtgaatcccgctcaggccttcagc
H2MP80_BOK-02      atggatgttctgaggcgttcctctgtttttgc--ggctgaggtcc-tggatgtgtttgag
H2MP80_BOK-01      atggatgttctgaggcgttcctctgtttttgc--ggctgaggtcc-tggatgtgtttgag
                    ****     *****    *** **   ****  *  ***   **    * *  **    

H2L9U3_BOK-02      cgctcagcccccactgacaaggagctggtgtcgcaggccaaagcgctgtgcagagagtac
H2MP80_BOK-02      cgatcg---ctgtctgagaaggagctggtgacccagtcgaaagcgttgtgcagagactac
H2MP80_BOK-01      cgatcg---ctgtctgagaaggagctggtgacccagtcgaaagcgttgtgcagagactac
                   ** **    *   **** ************ * *** * ****** ********** ***

H2L9U3_BOK-02      atccactccaggctgaaccgagccggcatcggttggtccaaacccgagcacgcgcaggct
H2MP80_BOK-02      atcctgtccagactccaccaaaatgggatggggtggtccaaagccgaaattaatttctct
H2MP80_BOK-01      atcctgtccagactccaccaaaatgggatggggtggtccaaagccgaaattaatttctct
                   ****  ***** **  *** *   ** ** ** ********* ****           **

H2L9U3_BOK-02      ggcgcaggcggtgcgctcggggaggtgtcttcggtcctcctgtggttgggcgaggagctg
H2MP80_BOK-02      ccctccaatgcggcactctccgaggtgactatggttcttctgtgtctaggagacgagctg
H2MP80_BOK-01      ccctccaatgcggcactctccgaggtgactatggttcttctgtgtctaggagacgagctg
                     * *    *  ** ***   ****** **  *** ** *****  * ** ** ******

H2L9U3_BOK-02      gagtaccttcggcccaatgtgtacaggaacgtcgctcgccagctgaacatcaccgtggcg
H2MP80_BOK-02      gagtgcatacagcctggtctgtacaggaacgtagcacggcagctcaacatttctgttgcc
H2MP80_BOK-01      gagtgcatacagcctggtctgtacaggaacgtagcacggcagctcaacatttctgttgcc
                   **** * * * ***   * ************* ** ** ***** *****  * ** ** 

H2L9U3_BOK-02      tcagagagcatcgtgtcggacgccttcctggctgtggccgcagacatcttctccactgga
H2MP80_BOK-02      atggagaacgtggtttcagatgccttccttggtgtggcaacagaaattttctc-------
H2MP80_BOK-01      atggagaacgtggtttcagatgccttccttggtgtggcaacagaaattttctc-------
                      **** * * ** ** ** ******** * ******  **** ** *****       

H2L9U3_BOK-02      agaattagtgaaaaacagaatcactgccacaaac----gtatcacgtgggggaaggtggt
H2MP80_BOK-02      agcag---------------------------------gtataacatggggcaaggtggt
H2MP80_BOK-01      agcagttttttcagccaaaacccaacagacagactccattataacatggggcaaggtggt
                   ** *                                   *** ** ***** ********

H2L9U3_BOK-02      ttccttgtatgcggtggcaggggctctggctgtggactgcgtccgccacggtcacccggc
H2MP80_BOK-02      gtccatgtatgcagtagctggagccctggctgtggattgtgtcagacaaggttacctcac
H2MP80_BOK-01      gtccatgtatgcagtagctggagccctggctgtggattgtgtcagacaaggttacctcac
                    *** ******* ** ** ** ** *********** ** *** * ** *** ***   *

H2L9U3_BOK-02      aatggtccacaccattgtggactgcatgggggagtttgcccgcaagagtctgaccgtgtg
H2MP80_BOK-02      caccgtgcacatcttggtggacagccttgggcagtttgttcgcaaattcctggttcactg
H2MP80_BOK-01      caccgtgcacatcttggtggacagccttgggcagtttgttcgcaaattcctggttcactg
                    *  ** **** * * ****** ** * *** ******  *****    ***      **

H2L9U3_BOK-02      gttgaaaaagagaggaggctgggtggacatgaccaaatgtgtggtgaacacggaccccag
H2MP80_BOK-02      gttaaaaaggagaggaggatgggctgagatcaccaaatgcgtggtgaagaaggagctcac
H2MP80_BOK-01      gttaaaaaggagaggaggatgggctgagatcaccaaatgcgtggtgaagaaggagctcac
                   *** **** ********* ****  ** ** ******** ******** * *** * ** 

H2L9U3_BOK-02      cttccactcccactggctgct------------ggctgccgtctgcgccttcggacacta
H2MP80_BOK-02      ctcagagcagccctggttgtcctccatcatggagtctgtcaagtacgctct----cacta
H2MP80_BOK-01      ctcagagcagccctggttgtcctccatcatggagtctgtcaagtacgctct----cacta
                   **   *    * **** **              * *** *   * ***  *    *****

H2L9U3_BOK-02      cctgaaggctgttgtgc-tgcacctcctcagagagaaatga
H2MP80_BOK-02      c---------gctgtacgtctacgtcatgaaggaaacgtga
H2MP80_BOK-01      c---------gctgtacgtctacgtcatgaaggaaacgtga
                   *         * *** * *  ** ** * *  ** *  ***

© 1998-2018