Dataset for CDS BAX-like of Organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2LIC3_BAX-01      atgg------catcgcaccccggaggaggcgatcaagaaaaatccaaaga-gctactgga
H2L9U3_BOK-02      ttggaaagcatgagg---gcctgtggggttgccagagtgaatcccgctcaggccttcagc
H2MP80_BOK-02      atggatgttctgaggcgttcctctgtttttgc--ggctgaggtcc-tggatgtgtttgag
H2MP80_BOK-01      atggatgttctgaggcgttcctctgtttttgc--ggctgaggtcc-tggatgtgtttgag
                    ***          *    **   *     *        *   **    * *        

H2LIC3_BAX-01      tgtgggcaccaagttgctgaagaacttcatctgtgaacgggtcaggagaaacctgcagga
H2L9U3_BOK-02      cgctcagcccccactgacaaggagct-----ggtgtcgcaggccaaagcgctgtgcaga-
H2MP80_BOK-02      cgatcg---ctgtctgagaaggagct-----ggtgacccagtcgaaagcgttgtgcaga-
H2MP80_BOK-01      cgatcg---ctgtctgagaaggagct-----ggtgacccagtcgaaagcgttgtgcaga-
                    *       *    **   * ** **      ***     * *   **     *****  

H2LIC3_BAX-01      tgactctgaagtggtcagacagcagctgggtgcagaggagctggttgacccaaa------
H2L9U3_BOK-02      -gagtacatccactccaggctgaaccgagcc-----ggcatcggttggtccaaacccgag
H2MP80_BOK-02      -gactacatcctgtccagactccaccaaaat-----gggatggggtggtccaaagccgaa
H2MP80_BOK-01      -gactacatcctgtccagactccaccaaaat-----gggatggggtggtccaaagccgaa
                    ** *          *** *   * *          **    ** **  *****      

H2LIC3_BAX-01      -------------ccacaagagacttgctcaatg-------------cctccagcagatt
H2L9U3_BOK-02      cacgcgcaggctggcgcaggcggtgcgctcggggaggtgtcttcggtcctcctgtggttg
H2MP80_BOK-02      attaatttctctccctccaatgcggcactctccgaggtgactatggttcttctgtgtcta
H2MP80_BOK-01      attaatttctctccctccaatgcggcactctccgaggtgactatggttcttctgtgtcta
                                 * *    *     ***   *              ** * *    * 

H2LIC3_BAX-01      ggagatgagctgg---------------------atgggaatgtag------agctcaaa
H2L9U3_BOK-02      ggcgaggagctggagtaccttcggcccaatgtgtacaggaacgtcgctcgccagctgaac
H2MP80_BOK-02      ggagacgagctggagtgcatacagcctggtctgtacaggaacgtagcacggcagctcaac
H2MP80_BOK-01      ggagacgagctggagtgcatacagcctggtctgtacaggaacgtagcacggcagctcaac
                   ** ** *******                     *  **** ** *      **** ** 

H2LIC3_BAX-01      agattgattgatgactcttcgctcagtccctccaaagaagtgtttctaaaagtggccctc
H2L9U3_BOK-02      a---tcaccgtggcgtcagagagcatcgtgtc---ggacgccttcctggctgtggccgca
H2MP80_BOK-02      a---tttctgttgccatggagaacgtggtttc---agatgccttccttggtgtggcaaca
H2MP80_BOK-01      a---tttctgttgccatggagaacgtggtttc---agatgccttccttggtgtggcaaca
                   *   *    *  *       *  *      **    ** *  ** **    *****    

H2LIC3_BAX-01      gagattttttctgatggggt------------------------------------atac
H2L9U3_BOK-02      gacatcttctccactggaagaattagtgaaaaacagaatcactgccacaaac----gtat
H2MP80_BOK-02      gaaattttctc-------agcag---------------------------------gtat
H2MP80_BOK-01      gaaattttctc-------agcagttttttcagccaaaacccaacagacagactccattat
                   ** ** ** **                                              ** 

H2LIC3_BAX-01      aac-tggggccgggtggttacacttttct------------acttcgcctgtcggctg-g
H2L9U3_BOK-02      cacgtgggggaaggtggtttc-cttgtatgcggtggcaggggctctggctgtggactgcg
H2MP80_BOK-02      aacatggggcaaggtggtgtc-catgtatgcagtagctggagccctggctgtggattgtg
H2MP80_BOK-01      aacatggggcaaggtggtgtc-catgtatgcagtagctggagccctggctgtggattgtg
                    ** *****   ******  * * * * *             *   * **** *  ** *

H2LIC3_BAX-01      tcataaaggctctcatcacaaaagtaccagacatcattagaactatattcacctggacca
H2L9U3_BOK-02      tccgccacggtcacccggcaatggtcc---acaccatt---------------------g
H2MP80_BOK-02      tcagacaaggttacctcaccaccgtgc---acatcttg---------------------g
H2MP80_BOK-01      tcagacaaggttacctcaccaccgtgc---acatcttg---------------------g
                   **    * * *  *    * *  ** *   *** * *                       

H2LIC3_BAX-01      tagattaccttcgggattatg------------tgattgcctggataagagagcaaggcg
H2L9U3_BOK-02      tggactgcatgggggagtttgcccgcaagagtctgaccgtgtggttgaaaaagagaggag
H2MP80_BOK-02      tggacagccttgggcagtttgttcgcaaattcctggttcactggttaaaaaggagaggag
H2MP80_BOK-01      tggacagccttgggcagtttgttcgcaaattcctggttcactggttaaaaaggagaggag
                   * **   * *  ** * * **            **      *** * * *  *  *** *

H2LIC3_BAX-01      gctgggatggcatcttt-----------------ggcactcctggctggcagacgttggc
H2L9U3_BOK-02      gctgggtggacatgaccaaatgtgtggtgaacacggaccccagcttccactcccactggc
H2MP80_BOK-02      gatgggctgagatcaccaaatgcgtggtgaagaaggagctcacctcagagcagccctggt
H2MP80_BOK-01      gatgggctgagatcaccaaatgcgtggtgaagaaggagctcacctcagagcagccctggt
                   * ****  *  **                     **  * *            *  *** 

H2LIC3_BAX-01      cgtc-------------tttgttgcaggcgttct----caccgc--------tgcggtg-
H2L9U3_BOK-02      tgct------------ggctgccgtctgcgccttcggacactacctgaaggctgttgtgc
H2MP80_BOK-02      tgtcctccatcatggagtctgtcaagtacgctct----cactac---------gctgtac
H2MP80_BOK-01      tgtcctccatcatggagtctgtcaagtacgctct----cactac---------gctgtac
                    *                 **       **   *    ***  *         *  **  

H2LIC3_BAX-01      ------gtcattcgcaagatgtga
H2L9U3_BOK-02      -tgcacctcctcagagagaaatga
H2MP80_BOK-02      gtctacgtcatgaaggaaacgtga
H2MP80_BOK-01      gtctacgtcatgaaggaaacgtga
                          ** *     * *  ***

© 1998-2018