Dataset for CDS BAX-like of Organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1SQZ2_BAX-01       ---------------------agtccaggcgcctcttccctcctctctcctctagggccc
G1SQZ2_BAX-02       ------gccgggccagagttggggtcagg------------------------agggccc
G1SHS9_BAK1-02      atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccc
G1SHS9_BAK1-01      atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccc
G1TXB3_BOK-01       ------gacgagttggagctgattcggcccagtgtctaccgcaacgtggcccgccagctc
                                                                            ** *

G1SQZ2_BAX-01       accagctctgagc-------agatcatgaagacaggggccctttt-----------gctt
G1SQZ2_BAX-02       accagctctgagc-------agatcatgaagacaggggccctttt-----------gctt
G1SHS9_BAK1-02      tccacttctgagcagcaggtagcccg-ggacacggaggaggtttt--ccgcagct-----
G1SHS9_BAK1-01      tccacttctgagcagcaggtagcccg-ggacacggaggaggtttt--ccgcagct-----
G1TXB3_BOK-01       cacatctccctgcagtccg-agcccgtggtgaccgacgcgttcctggccgtggctggcca
                      **  **   **       **  *  *   ** *  *   *  *               

G1SQZ2_BAX-01       cagggtttcatccaggacc----gggccagccggatgggggggcagacgccc--------
G1SQZ2_BAX-02       cagggtttcatccaggacc----gggccagccggatgggggggcagacgccc--------
G1SHS9_BAK1-02      -acgttttccaccgccaccggcaggagcaggaggccgagggggcggctgcccctgctgac
G1SHS9_BAK1-01      -acgttttccaccgccaccggcaggagcaggaggccgagggggcggctgcccctgctgac
G1TXB3_BOK-01       catcttctctgcaggcatcacgtggggca-------------------------------
                     *   * **  *    * *    **  **                               

G1SQZ2_BAX-01       ---------------------------------gagctggctgtggcgcaggggccccag
G1SQZ2_BAX-02       ---------------------------------gagctggctgtggcgcaggggccccag
G1SHS9_BAK1-02      ccggagatgatctccttgcac-ctggaacctaacagc--accatggggcaggtggggcgg
G1SHS9_BAK1-01      ccggagatgatctccttgcac-ctggaacctaacagc--accatggggcaggtggggcgg
G1TXB3_BOK-01       ----aggtggtgtccctgtatgctgtggccgcagggctggccgtggactgcgtgcggcag
                                                       **   *  ***     * *   * *

G1SQZ2_BAX-01       gacgagtccaccaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagt
G1SQZ2_BAX-02       gacgagtccaccaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagt
G1SHS9_BAK1-02      ---cagctcgccatcattggggacgacatcaaccagcgctatgactcagatttccagaac
G1SHS9_BAK1-01      ---cagctcgccatcattggggacgacatcaaccagcgctatgactcagatttccagaac
G1TXB3_BOK-01       gcccagcccgccat----------------------------------------------
                        **  * ***                                               

G1SQZ2_BAX-01       aacatggagctacagaggatgatcgctgccgtggacacggactccccccgcgaggtcttt
G1SQZ2_BAX-02       aacatggagctacagaggatgatcgctgccgtggacacggactccccccgcgaggtcttt
G1SHS9_BAK1-02      atgctagagaagctgca---gcccacggccgagaacg---------cctatgagctgttc
G1SHS9_BAK1-01      atgctagagaagctgca---gcccacggccgagaacg---------cctatgagctgttc
G1TXB3_BOK-01       ----------------g---gtccacgccctgg---------------------------
                                        *  * *  **  *                           

G1SQZ2_BAX-01       ttccgagtggcagccgacatgtttgccgacggcaacttcaactggggccgcgttgtcg--
G1SQZ2_BAX-02       ttccgagtggcagccgacatgtttgccgacggcaacttcaactggggccgcgttgtcg--
G1SHS9_BAK1-02      accaagatcgccttgagcctgtttgagagtggca---tcaactggggccgcgtggtggct
G1SHS9_BAK1-01      accaagatcgccttgagcctgtttgagagtggca---tcaactggggccgcgtggtggct
G1TXB3_BOK-01       ------------ttga--ctgcctgggg---------------gagtttgtgcggaag--
                                       **  **                  * *   * *  *  *  

G1SQZ2_BAX-01       --ccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctga
G1SQZ2_BAX-02       --ccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctga
G1SHS9_BAK1-02      ctcctggccttcggctaccgcc-------------tggccctgtacatctaccggcgcgg
G1SHS9_BAK1-01      ctcctggccttcggctaccgcc-------------tggccctgtacatctaccggcgcgg
G1TXB3_BOK-01       accctgg----------ccacc-------------tggctgcgg--------cggcgcgg
                      **  *          ** **              ***   *           **  * 

G1SQZ2_BAX-01       gctcatcaggactattatgggctggacgctggacttcctccgagagcggctgctgggc--
G1SQZ2_BAX-02       gctcatcaggactattatgggctggacgctggacttcctccgagagcggctgctgggc--
G1SHS9_BAK1-02      cctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgactttgtggtgc
G1SHS9_BAK1-01      cctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgactttgtggtgc
G1TXB3_BOK-01       ----------------------cggat----ggaccga--cgtgctcaagtgtgtggt-c
                                            *      *        ** *  *   *    **   

G1SQZ2_BAX-01       -----------------tggatccaagaccagggtggttgg---gacggcctcctctcct
G1SQZ2_BAX-02       -----------------tggatccaagaccagggtggttgg---gacggcctcctctcct
G1SHS9_BAK1-02      atcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgc
G1SHS9_BAK1-01      atcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgc
G1TXB3_BOK-01       agcac-------------ggacc--------------ctgg--------cctccgctccc
                                      *** *               ***        ***   ***  

G1SQZ2_BAX-01       acttcgggacccccacgtggcaaacgct-gaccatcttgggggccggagtgctcacc---
G1SQZ2_BAX-02       acttcgggacccccacgtggcaaacgct-gaccatcttgggggccggagtgctcacc---
G1SHS9_BAK1-02      aca-----accccatcctgac-agtgct-ggcggccctggccgtggtcgcgttctgccag
G1SHS9_BAK1-01      aca-----accccatcctgac-agtgct-ggcggccctggccgtggtcgcgttctgccag
G1TXB3_BOK-01       act-----ggc---tcctggc-tgcgctctgcagcctcggccgc-------ttcctcaag
                    **        *    * ** *    ***   *   *  **  *         **  *   

G1SQZ2_BAX-01       ---gcctcactcaccatctggaagaaga-------tgggctga
G1SQZ2_BAX-02       ---gcctcactcaccatctggaagaaga-------tgggc---
G1SHS9_BAK1-02      ---------ttcgtggta----cgaagacacttcaagtcatga
G1SHS9_BAK1-01      ---------ttcgtggta----cgaagacacttcaagtcatga
G1TXB3_BOK-01       gcggctgtctttgtgctgttgccggaga----------gatga
                              *     *      * ***               

© 1998-2018