Dataset for CDS BAX of Organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1SQZ2_BAX-01      ---------------agtccaggcgcctcttccctcctctctcctctagggcccaccagc
G1SQZ2_BAX-02      gccgggccagagttggggtcagg------------------------agggcccaccagc
                                   *  ****                        *************

G1SQZ2_BAX-01      tctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaggaccgggcc
G1SQZ2_BAX-02      tctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaggaccgggcc
                   ************************************************************

G1SQZ2_BAX-01      agccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacgagtcc
G1SQZ2_BAX-02      agccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacgagtcc
                   ************************************************************

G1SQZ2_BAX-01      accaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggag
G1SQZ2_BAX-02      accaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggag
                   ************************************************************

G1SQZ2_BAX-01      ctacagaggatgatcgctgccgtggacacggactccccccgcgaggtctttttccgagtg
G1SQZ2_BAX-02      ctacagaggatgatcgctgccgtggacacggactccccccgcgaggtctttttccgagtg
                   ************************************************************

G1SQZ2_BAX-01      gcagccgacatgtttgccgacggcaacttcaactggggccgcgttgtcgccctgttttac
G1SQZ2_BAX-02      gcagccgacatgtttgccgacggcaacttcaactggggccgcgttgtcgccctgttttac
                   ************************************************************

G1SQZ2_BAX-01      tttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatcaggact
G1SQZ2_BAX-02      tttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatcaggact
                   ************************************************************

G1SQZ2_BAX-01      attatgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccag
G1SQZ2_BAX-02      attatgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccag
                   ************************************************************

G1SQZ2_BAX-01      ggtggttgggacggcctcctctcctacttcgggacccccacgtggcaaacgctgaccatc
G1SQZ2_BAX-02      ggtggttgggacggcctcctctcctacttcgggacccccacgtggcaaacgctgaccatc
                   ************************************************************

G1SQZ2_BAX-01      ttgggggccggagtgctcaccgcctcactcaccatctggaagaagatgggctga
G1SQZ2_BAX-02      ttgggggccggagtgctcaccgcctcactcaccatctggaagaagatgggc---
                   ***************************************************   

© 1998-2018