Dataset for CDS BAK1 of Organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1SHS9_BAK1-02      atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccc
G1SHS9_BAK1-01      atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccc
                    ************************************************************

G1SHS9_BAK1-02      tccacttctgagcagcaggtagcccgggacacggaggaggttttccgcagctacgttttc
G1SHS9_BAK1-01      tccacttctgagcagcaggtagcccgggacacggaggaggttttccgcagctacgttttc
                    ************************************************************

G1SHS9_BAK1-02      caccgccaccggcaggagcaggaggccgagggggcggctgcccctgctgacccggagatg
G1SHS9_BAK1-01      caccgccaccggcaggagcaggaggccgagggggcggctgcccctgctgacccggagatg
                    ************************************************************

G1SHS9_BAK1-02      atctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
G1SHS9_BAK1-01      atctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
                    ************************************************************

G1SHS9_BAK1-02      attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctg
G1SHS9_BAK1-01      attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctg
                    ************************************************************

G1SHS9_BAK1-02      cagcccacggccgagaacgcctatgagctgttcaccaagatcgccttgagcctgtttgag
G1SHS9_BAK1-01      cagcccacggccgagaacgcctatgagctgttcaccaagatcgccttgagcctgtttgag
                    ************************************************************

G1SHS9_BAK1-02      agtggcatcaactggggccgcgtggtggctctcctggccttcggctaccgcctggccctg
G1SHS9_BAK1-01      agtggcatcaactggggccgcgtggtggctctcctggccttcggctaccgcctggccctg
                    ************************************************************

G1SHS9_BAK1-02      tacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
G1SHS9_BAK1-01      tacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
                    ************************************************************

G1SHS9_BAK1-02      tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtc
G1SHS9_BAK1-01      tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtc
                    ************************************************************

G1SHS9_BAK1-02      ctgagctcgcacaaccccatcctgacagtgctggcggccctggccgtggtcgcgttctgc
G1SHS9_BAK1-01      ctgagctcgcacaaccccatcctgacagtgctggcggccctggccgtggtcgcgttctgc
                    ************************************************************

G1SHS9_BAK1-02      cagttcgtggtacgaagacacttcaagtcatga
G1SHS9_BAK1-01      cagttcgtggtacgaagacacttcaagtcatga
                    *********************************

© 1998-2018