Dataset for CDS BOK of Organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3KT16_BOK-01      atggagatgttgcgtcgctcctctgtgtttgc---------ctctgaagtgtttgaccgc
I3JU52_BOK-01      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccga
I3JU52_BOK-02      atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccga
                   ****** *  ****  * ** ** ********         *   ** *********** 

I3KT16_BOK-01      tcgcccaccgacaaggagctggtgtcccaagccaaagcactgtgcagggaatacatccac
I3JU52_BOK-01      tcactgaccgagaaggagctggtttcccagtctaaggcgctgtgcagagactacatcctg
I3JU52_BOK-02      tcactgaccgagaaggagctggtttcccagtctaaggcgctgtgcagagactacatcctg
                   ** *  ***** *********** *****  * ** ** ******** ** *******  

I3KT16_BOK-01      tccaggctgaaccgtgccgggatcggctggtccaagcctgaacacggactggctgcatca
I3JU52_BOK-01      tcgaggctcaaccagaacgggttgggatggtccaaaactgagctcaatttttctccctcg
I3JU52_BOK-02      tcgaggctcaaccagaacgggttgggatggtccaaaactgagctcaatttttctccctcg
                   ** ***** ****    **** * ** ********  **** * *    *  ** * ** 

I3KT16_BOK-01      ggtgggacactgggagagatatcgtcggtcctgctgtggctgggcgatgagttggagtac
I3JU52_BOK-01      aacgcagcgctagctgaagtatctatggtgcttctctgtcttggcgatgagctggagtgt
I3JU52_BOK-02      aacgcagcgctagctgaagtatctatggtgcttctctgtcttggcgatgagctggagtgt
                      *   * ** *  **  ****   *** ** ** ** ** ********* ******  

I3KT16_BOK-01      cttcgtcccaatgtgtaccgtaacgtcgcccgacagctgaacatcacagtggcatcggag
I3JU52_BOK-01      atacagcccagtttgtacaggaacgtggcgcggcaactcaacatttctgttgccatggag
I3JU52_BOK-02      atacagcccagtttgtacaggaacgtggcgcggcaactcaacatttctgttgccatggag
                    * *  **** * ***** * ***** ** ** ** ** *****  * ** **   ****

I3KT16_BOK-01      agcgtggtgtccgacgctttcctagctgtcgctgcagacattttctcc------------
I3JU52_BOK-01      aacatggtttcggatgccttcatcggcgtagcaacagagattttctca------------
I3JU52_BOK-02      aacatggtttcggatgccttcatcggcgtagcaacagagattttctcacgtaaagccagc
                   * * **** ** ** ** *** * *  ** **  **** ********             

I3KT16_BOK-01      ---------------------acaggtgtgacatggggaaaggtggtttccttgtacgct
I3JU52_BOK-01      ---------------------gcaggcataacatggggtaaggtggtgtccatgtacgcg
I3JU52_BOK-02      aggtcccatcttgggcctcacataggcataacatggggtaaggtggtgtccatgtacgcg
                                          ***  * ******** ******** *** ******* 

I3KT16_BOK-01      gtggcgggagccttggcggtggactgtgtccgccatggtcatccagcaatggtccatacc
I3JU52_BOK-01      gtagctggagccctggcagtggactgtgtcagacaaggccatccggccacagtgcacatc
I3JU52_BOK-02      gtagctggagccctggcagtggactgtgtcagacaaggccatccggccacagtgcacatc
                   ** ** ****** **** ************ * ** ** ***** ** *  ** ** * *

I3KT16_BOK-01      attgtcgactgcatgggggagtttgtccgcaagagcctgatttcctggttaaaaaagaga
I3JU52_BOK-01      ttagtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaagagacgg
I3JU52_BOK-02      ttagtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaagagacgg
                    * ** *** *  ****  *************   **** ** ***** * ** *   * 

I3KT16_BOK-01      ggaggctgggtggatgtaacaaagtgcgtggtgagcactgacccaaacttctgttctc--
I3JU52_BOK-01      ggaggatgggtggagatcacaaaatgtgtggtaaagaagga--------tctttcccctg
I3JU52_BOK-02      ggaggatgggtggagatcacaaaatgtgtggtaaagaagga--------tctttcccctg
                   ***** ********  * ***** ** ***** *  *  **        *** * * *  

I3KT16_BOK-01      ------actggctggtgtctgctgtctgtgcctttggacactacctgaagacggtcgtgc
I3JU52_BOK-01      aagaaaactggctgtcctccgcctttgagtccctcaagtacttcctcaccac---catg-
I3JU52_BOK-02      aagaaaactggctgtcctccgcctttgagtccctcaagtacttcctcaccac---catg-
                         ********   ** **  *     ** *     *** *** *  **   * ** 

I3KT16_BOK-01      tacacctcctccgcgagaa----gtga
I3JU52_BOK-01      tacgtctacattatgaaggagccgtga
I3JU52_BOK-02      tacgtctacattatgaaggagccgtga
                   ***  ** *     **       ****

© 1998-2019