Dataset for CDS BAX-like of Organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3IYF0_BAX-01      atggcatcacacccaggaggaggcgatcaagggaattccggagatcagatactg--gaag
I3KNV2_BAX-01      atggctgacggccgagagggggagaatccggag----caggagcctag-gggcgccgcgg
I3KT16_BOK-01      atgg-------------------agatgttgcg----tcgctcctctgtgtttgc-----
I3JU52_BOK-01      atgg-------------------aggtcctgcg----caggtcttcagtgtttgctgcag
I3JU52_BOK-02      atgg-------------------aggtcctgcg----caggtcttcagtgtttgctgcag
                   ****                      *   * *      *       *     *      

I3IYF0_BAX-01      tcggaactattttgttacaggatttcatctatgagcgag-----------ttcagaggca
I3KNV2_BAX-01      gtggagacgatgtcattgatgatcccatcctcgaagaaggagcggttgtctttagagggt
I3KT16_BOK-01      ----ctctgaagtgtttgaccg-ctcgcccaccgacaaggagctggtgtccc---aagcc
I3JU52_BOK-01      aggtcctggatgtgtttgaccg-atcactgaccgagaaggagctggtttccc---agtct
I3JU52_BOK-02      aggtcctggatgtgtttgaccg-atcactgaccgagaaggagctggtttccc---agtct
                               *  *  *      *           **                *    

I3IYF0_BAX-01      aaaagatggc-------aataaa------------------gcagtgacgagagaacagc
I3KNV2_BAX-01      atgtgattgcacatataaacacagaggaccctagtcgacatgtgacttctgaggatttgg
I3KT16_BOK-01      aaagcactgtgcagg-gaataca------tccactccaggctgaaccgtgccgggatcgg
I3JU52_BOK-01      aaggcgctgtgcaga-gactaca------tcctgtcgaggctcaaccagaacgggttggg
I3JU52_BOK-02      aaggcgctgtgcaga-gactaca------tcctgtcgaggctcaaccagaacgggttggg
                   *       *        *  * *                              *    * 

I3IYF0_BAX-01      ttggtggaagccagttgactgac-----ccaaaaactaagaagcttgctcag--------
I3KNV2_BAX-01      gagg--aaggccagatgaacaacaggatccacaaatcaaagaagtggtagaa--------
I3KT16_BOK-01      ctggtccaagcctgaacacggactggctgcatcaggtgggacactgggagagatatcgtc
I3JU52_BOK-01      atggtccaaaactgagctcaatttttctccctcgaacgcagcgctagctgaagtatctat
I3JU52_BOK-02      atggtccaaaactgagctcaatttttctccctcgaacgcagcgctagctgaagtatctat
                     **   *   * *               *              * *   *         

I3IYF0_BAX-01      -tgcctgcagcagattggagacgagctgga---------------------tggaaatgt
I3KNV2_BAX-01      ----------cagctgcgcaagatagcgga------------cagtttaaatcggaatgc
I3KT16_BOK-01      ggtcctgctgtggctgggcgatgagttggagtaccttcgtcccaatgtgtaccgtaacgt
I3JU52_BOK-01      ggtgcttctctgtcttggcgatgagctggagtgtatacagcccagtttgtacaggaacgt
I3JU52_BOK-02      ggtgcttctctgtcttggcgatgagctggagtgtatacagcccagtttgtacaggaacgt
                                 *  *  *      ***                       * ** * 

I3IYF0_BAX-01      agacctccaaagaatgataaatgactcttcactttgtcccacaagagag-----------
I3KNV2_BAX-01      tgaacttcagaggctgataaac----c-------aggttca--ggggaactgtgctcaag
I3KT16_BOK-01      cgccc------gacagctgaacatcac-------agtggcatcggagagcgtggtgtccg
I3JU52_BOK-01      ggcgc------ggcaactcaacatttc-------tgttgccatggagaacatggtttcgg
I3JU52_BOK-02      ggcgc------ggcaactcaacatttc-------tgttgccatggagaacatggtttcgg
                    *  *      *     * **     *        *   *    * **            

I3IYF0_BAX-01      --gtttttatgagagtggcctatgagatcttttca-------------------------
I3KNV2_BAX-01      acgtcttcatgactgttgcaagaaacatctttgct-------------------------
I3KT16_BOK-01      acgctttcctagctgtcgctgcagacattttctcc-------------------------
I3JU52_BOK-01      atgccttcatcggcgtagcaacagagattttctca-------------------------
I3JU52_BOK-02      atgccttcatcggcgtagcaacagagattttctcacgtaaagccagcaggtcccatcttg
                     *  **  *    ** **     * ** **  *                          

I3IYF0_BAX-01      --------gatggaatatttaactggggcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
I3KNV2_BAX-01      --------gatggtatc---aactggggtcgaatagtggctctcttccatctggcctgta
I3KT16_BOK-01      --------acaggtgtg---acatggggaaaggtggtttccttgtacgctgtggcggg--
I3JU52_BOK-01      --------gcaggcata---acatggggtaaggtggtgtccatgtacgcggtagctgg--
I3JU52_BOK-02      ggcctcacataggcata---acatggggtaaggtggtgtccatgtacgcggtagctgg--
                              **  *    *  *****                                

I3IYF0_BAX-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn----------------------
I3KNV2_BAX-01      aacttatacacaaggctattaccgccaa--tcacttggagaacatccaaatgatcatcag
I3KT16_BOK-01      agccttggcggtggactgtgtccgccatggtcatccagcaatggtccataccattgtcga
I3JU52_BOK-01      agccctggcagtggactgtgtcagacaaggccatccggccacagtgcacatcttagtgga
I3JU52_BOK-02      agccctggcagtggactgtgtcagacaaggccatccggccacagtgcacatcttagtgga

I3IYF0_BAX-01      ------------------------------------------------------------
I3KNV2_BAX-01      ctgggtcctccaggttatcagagag---caggtctacagctggcttgtggcgcaaggggg
I3KT16_BOK-01      ctgcatgggggagtttgtccgcaagagcctgatttc---ctggttaaaaaagagaggagg
I3JU52_BOK-01      cagtctgggacagtttgtccgcaaattcctggttcc---ctggctgaagagacggggagg
I3JU52_BOK-02      cagtctgggacagtttgtccgcaaattcctggttcc---ctggctgaagagacggggagg

I3IYF0_BAX-01      ------------------------------------------------------------
I3KNV2_BAX-01      ctgggagggggtga-----tccgtggt-------------------ttttctc-------
I3KT16_BOK-01      ctgggtggatgtaacaaagtgcgtggtgagcactgacccaaacttctgttctc-------
I3JU52_BOK-01      atgggtggagatcacaaaatgtgtggtaaagaagga--------tctttcccctgaagaa
I3JU52_BOK-02      atgggtggagatcacaaaatgtgtggtaaagaagga--------tctttcccctgaagaa

I3IYF0_BAX-01      ------------------------------------------------------------
I3KNV2_BAX-01      -gatggaggacagcagccatggtagcatcagtagtattggtggtagcc--------ttcg
I3KT16_BOK-01      -actggctggtgtctgctgtctgtgcctttg-gacactacctgaagacggtcgtgctaca
I3JU52_BOK-01      aactggctgtcctccgcctttgagtccctca-agtacttcctcaccac---catg-tacg
I3JU52_BOK-02      aactggctgtcctccgcctttgagtccctca-agtacttcctcaccac---catg-tacg

I3IYF0_BAX-01      -----------------------
I3KNV2_BAX-01      tttactaccggaaagtacgataa
I3KT16_BOK-01      cctcctccgcgagaa----gtga
I3JU52_BOK-01      tctacattatgaaggagccgtga
I3JU52_BOK-02      tctacattatgaaggagccgtga

© 1998-2019