Dataset for CDS BAX of Organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3IYF0_BAX-01      atggcatcacacccaggaggaggcgatcaagggaattccggagatca--gatactggaag
I3KNV2_BAX-01      atggc-tgacggccgagagggggagaatccggag---caggagcctaggggcgccgcggg
                   ***** * **  **  **** ** **    **     * ****   *  *   * *   *

I3IYF0_BAX-01      tcggaactattttgttacaggatttcatctatgagcgag-----------ttcagaggca
I3KNV2_BAX-01      tggagacgatgtcattg-atgatcccatcctcgaagaaggagcggttgtctttagagggt
                   * *  ** ** *  **  * ***  ****   **   **           ** *****  

I3IYF0_BAX-01      aaaagatggca---------ataaagca-------------gtgacgagagaacagcttg
I3KNV2_BAX-01      atgtgattgcacatataaacacagaggaccctagtcgacatgtgacttctgaggatttgg
                   *   *** ***         * * ** *             *****    **  *  * *

I3IYF0_BAX-01      gtggaa-gccagttgact-----gacccaaaaactaagaagcttgctcagtgcctgcagc
I3KNV2_BAX-01      gaggaaggccagatgaacaacaggatccacaaatcaaagaagtggtagaacagctgcgca
                   * **** ***** ***       ** *** ***  **  *  * *   *    ****   

I3IYF0_BAX-01      agattggagacgagctggatggaaatgtagacctccaaagaatgataaatga--------
I3KNV2_BAX-01      agatagcggacagtttaaatcggaatgctgaacttcagaggctgataaaccaggttcagg
                   **** *  ***    *  ** * ****  ** ** ** **  *******  *        

I3IYF0_BAX-01      ------------------------------------------------------------
I3KNV2_BAX-01      ggaactgtgctcaagacgtcttcatgactgttgcaagaaacatctttgctgatggtatca
                                                                               

I3IYF0_BAX-01      --------------------ctcttcactttgtcc------------cacaaga------
I3KNV2_BAX-01      actggggtcgaatagtggctctcttccatctggcctgtaaacttatacacaaggctatta
                                       ******  * ** **            ******       

I3IYF0_BAX-01      -----------------------------------------------gaggtttttatga
I3KNV2_BAX-01      ccgccaatcacttggagaacatccaaatgatcatcagctgggtcctccaggttatca-ga
                                                                   ***** * * **

I3IYF0_BAX-01      gag------------tggcctatga-----------------------------gatctt
I3KNV2_BAX-01      gagcaggtctacagctggcttgtggcgcaagggggctgggagggggtgatccgtggtttt
                   ***            **** * **                              * * **

I3IYF0_BAX-01      ttcagatggaatat-ttaactggggcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
I3KNV2_BAX-01      tctcgatggaggacagcagccatggtagcatcagtagtattggtggtagccttcgtttac
                   *   ******  *    * *   ** **                                

I3IYF0_BAX-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
I3KNV2_BAX-01      taccggaaagtacgataa-----------------
                                                      

© 1998-2018