Dataset for CDS BAX-like of Organism Octopus bimaculoides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0L8HMQ8_BAX-01      atgtattccttgaatgtccattgcaccatgatcaaatctacacaag---a
A0A0L8HMQ8_BAX-02      atggatctcgagga---------------gagaaaa---atacgggctaa
                       *** **  *  * *               **  ***   * **  *   *

A0A0L8HMQ8_BAX-01      accgcccaggaaaaacttaaacagagatgacgtgggcaaccaggcgcggt
A0A0L8HMQ8_BAX-02      accgcccaggaaaaacttaaacagagatgacgtgggcaaccaggcgcggt
                       **************************************************

A0A0L8HMQ8_BAX-01      gtttgctgaaccagttcatccatgacagaatggaaaatgaaggctttgaa
A0A0L8HMQ8_BAX-02      gtttgctgaaccagttcatccatgacagaatggaaaatgaaggctttgaa
                       **************************************************

A0A0L8HMQ8_BAX-01      aatcctctgcaagagtccaacctcatcgaaccagacacaccaacaggtcc
A0A0L8HMQ8_BAX-02      aatcctctgcaagagtccaacctcatcgaaccagacacaccaacaggtcc
                       **************************************************

A0A0L8HMQ8_BAX-01      accgatgtctcagctagaagaaataggacgtgctctacggtgtattggtg
A0A0L8HMQ8_BAX-02      accgatgtctcagctagaagaaataggacgtgctctacggtgtattggtg
                       **************************************************

A0A0L8HMQ8_BAX-01      acgaattagatggagaccaaagactgcaagatttggtatcaagaatagag
A0A0L8HMQ8_BAX-02      acgaattagatggagaccaaagactgcaagatttggtatcaagaatagag
                       **************************************************

A0A0L8HMQ8_BAX-01      cctgaagatattcccaatacatttctcaatgttgccagtgctattgtctc
A0A0L8HMQ8_BAX-02      cctgaagatattcccaatacatttctcaatgttgccagtgctattgtctc
                       **************************************************

A0A0L8HMQ8_BAX-01      tgtaaaccttacttgggatatagtggttcggttcttttactttgcctaca
A0A0L8HMQ8_BAX-02      tgtaaaccttacttgggatatagtggttcggttcttttactttgcctaca
                       **************************************************

A0A0L8HMQ8_BAX-01      aaatggccatcaaggcattggaccggattcctttaatccgagccatcatc
A0A0L8HMQ8_BAX-02      aaatggccatcaaggcattggaccggattcctttaatccgagccatcatc
                       **************************************************

A0A0L8HMQ8_BAX-01      aacttagttattaattttatagtagacaatcttgctgattggattctatc
A0A0L8HMQ8_BAX-02      aacttagttattaattttatagtagacaatcttgctgattggattctatc
                       **************************************************

A0A0L8HMQ8_BAX-01      tcgaggtggatgggaagccattgtggaatattttggcaccccaaagaggc
A0A0L8HMQ8_BAX-02      tcgaggtggatgggaagccattgtggaatattttggcaccccaaagaggc
                       **************************************************

A0A0L8HMQ8_BAX-01      aagcctttggcgttttaatagccggtgttcttatcagtgttggcgtctat
A0A0L8HMQ8_BAX-02      aagcctttggcgttttaatagccggtgttcttatcagtgttggcgtctat
                       **************************************************

A0A0L8HMQ8_BAX-01      gcgtggaagagtattggtaattaa
A0A0L8HMQ8_BAX-02      gcgtggaagagtattggtaattaa
                       ************************

© 1998-2018