Dataset for CDS BAX-like of Organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1R8A1_BOK-01           --atggaggtgctgcggcgctcctcgg----tcttcgccgccgagatcat
G1QXN2_BAX-01           cagatcatgaagacaggggccc----------ttttgcttcagggtttca
A0A2I3GW67_BAK1-01      --gagcaggtagcccgggacacagaggaggttttccgcagctacgttttt
A0A2I3GW67_BAK1-02      --gagcaggtagcccgggacacagaggaggttttccgcagctacgttttt
                              * *      **  * *           *  **  *   * *   

G1R8A1_BOK-01           ggacgcctttgaccgctcgcccaccgacaaggagctggtggcccaggcca
G1QXN2_BAX-01           tccaggatcgagcag--------------ggcgaatggggggggaggcac
A0A2I3GW67_BAK1-01      taccgccatcagcag---------gaacaggaggctgaaggggcagctgc
A0A2I3GW67_BAK1-02      taccgccatcagcag---------gaacaggaggctgaaggggcagctgc
                            *       * *               *    **  **   **    

G1R8A1_BOK-01           aggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctc
G1QXN2_BAX-01           ccgagctggccc-----t------------ggacccggtgc---------
A0A2I3GW67_BAK1-01      ccctgccgacccagagat------------ggtcaccttac---------
A0A2I3GW67_BAK1-02      ccctgccgacccagagat------------ggtcaccttac---------
                            ** *  **     *            **   *    *         

G1R8A1_BOK-01           tcttggagcgcgcccgagcg-cgccgcggtcccgggacgcctggccgagg
G1QXN2_BAX-01           -ctcaggatgcgtc-------caccaaga---------------------
A0A2I3GW67_BAK1-01      -ctc----tgcaacccagcagcaccatgg---------------------
A0A2I3GW67_BAK1-02      -ctc----tgcaacccagcagcaccatgg---------------------
                         **      **  *       * **  *                      

G1R8A1_BOK-01           tgtgcgcggtgctgctgcgcctgggggatgagctggagatgatccggccc
G1QXN2_BAX-01           ---------------agc---tgagcgagtgtctcaagcgcatcggggac
A0A2I3GW67_BAK1-01      ---------------ggcaggtgggacggcagctcgccatcatcggggac
A0A2I3GW67_BAK1-02      ---------------ggcaggtgggacggcagctcgccatcatcggggac
                                        **   ** *       **       *** **  *

G1R8A1_BOK-01           agcatctaccgcaacgtggcgcgtcag---ctgcacatctccctgcagtc
G1QXN2_BAX-01           gaactggacagtaacatggagctgcagaggatgat--------tgctgcc
A0A2I3GW67_BAK1-01      gacatcaaccg---------acttcaggccatgttgcagcacctgcagcc
A0A2I3GW67_BAK1-02      gacatcaaccg---------acttcaggccatgttgcagcacctgcagcc
                            *  ** *          *  ***    **          *** * *

G1R8A1_BOK-01           tgagcctgtggtgaccgatgcgttcctggccgtggctggccac-------
G1QXN2_BAX-01           gtggacacagactccccacgag----------aggtctttttccgagtgg
A0A2I3GW67_BAK1-01      cacggcagagaatgtctatgagtacttcaccaagattgcctc--------
A0A2I3GW67_BAK1-02      cacggcagagaatgtctatgagtacttcaccaagattgcctccaggccag
                           * *   *     * * * *           *                

G1R8A1_BOK-01           -------------atcttctctgcagg---catcacgtggggcaaggtgg
G1QXN2_BAX-01           cagctgaa-----atgttttctgacggcaacttcaactggggccgggttg
A0A2I3GW67_BAK1-01      ------------cagcctgtttgagagtggcatcaactggggccgtgtgg
A0A2I3GW67_BAK1-02      cagcaacacccacagcctgtttgagagtggcatcaactggggccgtgtgg
                                     *   * * **   *   * ***  ******   ** *

G1R8A1_BOK-01           t-gtccctgtatgcggtggccgcggggctggccgtggactgtgtgaggca
G1QXN2_BAX-01           tcgcccttttctactttgccagcaaactggtgctca-------------a
A0A2I3GW67_BAK1-01      tggctcttctggctttcggctac---------cgta-------------t
A0A2I3GW67_BAK1-02      tggctcttctggctttcggctac---------cgta-------------t
                        * *  * * *       * *  *         *                 

G1R8A1_BOK-01           ggcccagcctgccatggtcca------------caccctcgtggactgc-
G1QXN2_BAX-01           ggccctgtgcaccaaggtgcccgaactgatcagaaccatcatgggctgg-
A0A2I3GW67_BAK1-01      ggccctacacgtc--------------------taccagcatggcctgac
A0A2I3GW67_BAK1-02      ggccctacacgtc--------------------taccagcatggcctga-
                        *****       *                     ***  * *** ***  

G1R8A1_BOK-01           ------------ctgggggagttcgtgcgcaagaccctggcga-------
G1QXN2_BAX-01           ------------acattggacttcctccgggagcggctgttgg-------
A0A2I3GW67_BAK1-01      tggcttcctgggccaggtgacccgcttcgtggttgacttcatgctgcatc
A0A2I3GW67_BAK1-02      --------------------------------------------------

G1R8A1_BOK-01           ------------cctggctgcggagacgcggcggatggactgatgtcctc
G1QXN2_BAX-01           ------------gctggatccaagaccagggtggttgggtgagactcctc
A0A2I3GW67_BAK1-01      gctgcattgcccggtggattgcacagaggggtggctgggtggcagccctg
A0A2I3GW67_BAK1-02      --------------------------------------------------

G1R8A1_BOK-01           aagtgtgtggtcagca-----cagaccctggcctccgctcccactggctg
G1QXN2_BAX-01           aagcctcctcaccctaaccaccacgccctcaccaccgcccctgccccacc
A0A2I3GW67_BAK1-01      ga-----------------------cttgggcaatggtcccatcctgatc
A0A2I3GW67_BAK1-02      --------------------------------------------------

G1R8A1_BOK-01           gtggccgc------------actctgcagcttcggccgcttcctgaaggc
G1QXN2_BAX-01           gtccctgcccccccaccactcctctgggaccctgg--gccttctggagca
A0A2I3GW67_BAK1-01      gt----------------------------gctgg--tggttctgggtgt
A0A2I3GW67_BAK1-02      --------------------------------------------------

G1R8A1_BOK-01           tgccttcttcgtgctgctgccagagag---------------------at
G1QXN2_BAX-01           ggtcacagtggtgccctctccccattgtaggatcatcagatgtggtttat
A0A2I3GW67_BAK1-01      ggttctgttgggccagtttgtggtacgaagattcttcaaa------tcat
A0A2I3GW67_BAK1-02      --------------------------------------------------

G1R8A1_BOK-01           ga
G1QXN2_BAX-01           aa
A0A2I3GW67_BAK1-01      ga
A0A2I3GW67_BAK1-02      --

© 1998-2019