Dataset for CDS BAK1 of Organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3GW67_BAK1-01      gagcaggtagcccgggacacagaggaggttttccgcagctacgtttttta
A0A2I3GW67_BAK1-02      gagcaggtagcccgggacacagaggaggttttccgcagctacgtttttta

A0A2I3GW67_BAK1-01      ccgccatcagcaggaacaggaggctgaaggggcagctgcccctgccgacc
A0A2I3GW67_BAK1-02      ccgccatcagcaggaacaggaggctgaaggggcagctgcccctgccgacc

A0A2I3GW67_BAK1-01      cagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtg
A0A2I3GW67_BAK1-02      cagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtg

A0A2I3GW67_BAK1-01      ggacggcagctcgccatcatcggggacgacatcaaccgacttcaggccat
A0A2I3GW67_BAK1-02      ggacggcagctcgccatcatcggggacgacatcaaccgacttcaggccat

A0A2I3GW67_BAK1-01      gttgcagcacctgcagcccacggcagagaatgtctatgagtacttcacca
A0A2I3GW67_BAK1-02      gttgcagcacctgcagcccacggcagagaatgtctatgagtacttcacca

A0A2I3GW67_BAK1-01      agattgcctc--------------------cagcctgtttgagagtggca
A0A2I3GW67_BAK1-02      agattgcctccaggccagcagcaacacccacagcctgtttgagagtggca
                        **********                    ********************

A0A2I3GW67_BAK1-01      tcaactggggccgtgtggtggctcttctggctttcggctaccgtatggcc
A0A2I3GW67_BAK1-02      tcaactggggccgtgtggtggctcttctggctttcggctaccgtatggcc

A0A2I3GW67_BAK1-01      ctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccg
A0A2I3GW67_BAK1-02      ctacacgtctaccagcatggcctga-------------------------

A0A2I3GW67_BAK1-01      cttcgtggttgacttcatgctgcatcgctgcattgcccggtggattgcac
A0A2I3GW67_BAK1-02      --------------------------------------------------

A0A2I3GW67_BAK1-01      agaggggtggctgggtggcagccctggacttgggcaatggtcccatcctg
A0A2I3GW67_BAK1-02      --------------------------------------------------

A0A2I3GW67_BAK1-01      atcgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
A0A2I3GW67_BAK1-02      --------------------------------------------------

A0A2I3GW67_BAK1-01      aagattcttcaaatcatga
A0A2I3GW67_BAK1-02      -------------------

© 1998-2019