Dataset for CDS BAX-like of Organism Myotis lucifugus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1PFJ7_BAX-01      atggacgggtccggggagcagcccagagacggggggcccaccagctctgagcagatcatg
G1QFV7_BOK-01      --------gcc----------cccaaggccgccgcgctc----gccccgggc--------
                           * *          ****  * **  * ** *    ** * * **        

G1PFJ7_BAX-01      aagacaggggcccttttactaaagcttcatccaaggaccaagcaga-gcacatgggggga
G1QFV7_BOK-01      --------ggccgcctcgcagaggtgt-------gcacggtgctgctgcgcctgggggat
                           ****   *  *  * *  *       * **   ** *  ** * ******  

G1PFJ7_BAX-01      gaggcgtccccagctgcccctggggcccagggtcccccaggatgcatccaccaagaagct
G1QFV7_BOK-01      gagctgg----agctgattc---ggccca--------------gcatctaccg-------
                   ***  *     *****   *   ******              ***** ***        

G1PFJ7_BAX-01      cagcgagtgcctcaagcgcattggcg-acgagctcgacagtaacatggagctgcagagga
G1QFV7_BOK-01      caacg----------------tggcgcgccagctgaacatctccctgcactctgagag--
                   ** **                *****  * ****  ***    * ** *     ****  

G1PFJ7_BAX-01      tgatcgcggctgtggacacagactccccccgagaggtcttcttccgagtggcgtccgaaa
G1QFV7_BOK-01      ----------cgtggtgaccgac------------gccttcctggctgtggccgcccaga
                              ****  ** ***            * **** *    *****  ** * *

G1PFJ7_BAX-01      tgttctccgacggcaacttcaactggggccgggttgtcgccctcttctactttgc-----
G1QFV7_BOK-01      tctttgctgcaggca---tcacgtggggcaaggtggtgtccctgtacttggtggctgcgg
                   * **  * *  ****   ***  ******  *** **  **** * **   * **     

G1PFJ7_BAX-01      ------cagcaaactg-gtgctcaaggccctgtgcaccaaagtgcctgagctgttcagga
G1QFV7_BOK-01      ggctggctgtggactgtgtgcggcaggcccagcccgccgtggttcatgctctcgtc--ga
                         * *   **** ****   ****** *  * **   ** * **  **  **  **

G1PFJ7_BAX-01      ccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggacc
G1QFV7_BOK-01      ctgcctcgg----------ggagtttgtgcgcaagaccctggcaacctggctgcggaggc
                   *   *  **          *** **  * **  **   ***     **** * * *   *

G1PFJ7_BAX-01      agggcggttgggacggcctcctctcctactttgggacctccacgtggcataccgtgacta
G1QFV7_BOK-01      gcggtggatggaccgacgtcct---caagtgtgtggtcagca----gca-accctggctt
                     ** ** ***  ** * ****   * * * ** *  *  **    *** *** ** ** 

G1PFJ7_BAX-01      tc-----------ttcgtggccggggt-----gctt--atcgcctcc-----atcaccta
G1QFV7_BOK-01      ccagtcccattggtttgtgactgcactctgcagcttcggccgcttcctgaaggctgcctt
                    *           ** *** * *   *     ****    *** ***         *** 

G1PFJ7_BAX-01      ctgtgagataatg------ggctga
G1QFV7_BOK-01      ctttgtgctgttgccagaaagatga
                   ** ** * *  **       * ***

© 1998-2018