Dataset for CDS BAX-like of Organism Mustela putorius furo

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3XW26_BAX-01       atgg--------------------------------acgggtccggggagca--------
M3XM76_BOK-01       atggaggtgctgcggcgttcctcagtcttcgcc-gcagaaatcatggacgcctttgaccg
M3XTL2_BAK1-01      atggcatccgggcaagg--cccaggtcctcccaggcagggatgtggagagcc--ggcccc
                    ****                                *    *   *   **         

M3XW26_BAX-01       ----------acccagaggcggggggccca--cca--gctctga----gcagatcatgaa
M3XM76_BOK-01       ctcgcccaccgacaaggagctggtggcccaggccaaggcgctgggccgggagttcgtgca
M3XTL2_BAK1-01      atcttctacttctgaggagcaggtagcccgggaca-----ctga---ggaggttttc---
                                  **  ** **  ****    **     ***     *  * *      

M3XW26_BAX-01       gacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatggggggaga
M3XM76_BOK-01       cgc-gcggc--tgctgcgcgctggcctcgcctg-----gagc---gcgcccgagcgcgcc
M3XTL2_BAK1-01      --c-gcagctatgttttttaccgccatcggcag-----gagca-ggaggctgagggggcg
                      * *  **  *  *       *   **  *       ****   * *   * * *    

M3XW26_BAX-01       gacacccgagctggcccttgagcaggcgcc-----acaggatgcat------ccaccaag
M3XM76_BOK-01       gct---cccgcc--cccgga---ggccgcctgg--ccgaggtgtgcgcggtgctgctgcg
M3XTL2_BAK1-01      gctgcgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatgggg
                    *     *  **   ***       * * **      *  *            *      *

M3XW26_BAX-01       aagctgagcgagtgtctcaagcgcatcggagatgaactggac------agtaacatggag
M3XM76_BOK-01       cctgggggacg--agctggagctgattcggcctagcgtctac---cgcaacgttgcccgt
M3XTL2_BAK1-01      caggtgggtcggcagcttgccatcatcggggacgacatcaaccagcgctacgactccgag
                         * *       **       **  *        *  **                  

M3XW26_BAX-01       ttacagaggatgatc--gcagctgtggacacagactccccccgcgaggtct-------tt
M3XM76_BOK-01       caactgaacatctccctgcaatctgagaccgtggtgac-----tgacgcct-------tc
M3XTL2_BAK1-01      ttccaggccatgctgcagcacctgcagccaacagcgga-----gaatgcctatgagtatt
                       * *   **      ***      * *                * * **       * 

M3XW26_BAX-01       ttccgagtggcagctgaaatgttttctgat--ggcaacttcaactggggtcgggtcgttg
M3XM76_BOK-01       ctggctgtggcgtcccagatcttctctgga--ggca---tcacatggggcaaggtggtgt
M3XTL2_BAK1-01      tcatcaagattgcctcgagcctgttcgagagtggca---ttaactggggccgcgtggtgg
                                 *       *  **      ****   * *  *****    ** **  

M3XW26_BAX-01       ccc--tcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccga
M3XM76_BOK-01       ccctgtactcagtggcggcag--ggctggccatcga-----ctgt-----gtgcg-----
M3XTL2_BAK1-01      ctc--tcctgagcttcggctaccgcctggccctcca-----cgtctaccagcgcg-----
                    * *  *  *       * *      ****   ** *                * *     

M3XW26_BAX-01       gctgatcaggaccatcatgggctggacactgg---acttccttcgagagcgactgctggg
M3XM76_BOK-01       gcaggcccagcccgccatggtccatgcacttgtcgactgccttggagaatttgtgc-gca
M3XTL2_BAK1-01      gcctgaccggct--tcctgggccagg---tgacccgcttcgtggctgacttcatgctgca
                    **    *  *     * *** *       *      ** * *    **     *** *  

M3XW26_BAX-01       c---------------tggatccaggaccagggtggttgggacggcctcctctcctactt
M3XM76_BOK-01       agaccctggcgccc--tggcttcgaaggcgtggtggatggaccgatgtcctcaagtgtgt
M3XTL2_BAK1-01      tcactgcattgctcggtggattgcgcagaggggcggctgg------------------gt
                                    *** *          ** ** ***                   *

M3XW26_BAX-01       tgggacaccc----acgtggcagacagtgaccatc--tttgtggctggagtgctcactgc
M3XM76_BOK-01       --ggtcagcacggagcctggcttccgct-cccattggctcgtggctgcac--tctgcagc
M3XTL2_BAK1-01      --gg-cagccctgaacttgggaaatggc-cccatc---------ctgaacgtgctgatag
                      ** ** *      * ***          ****          *** *           

M3XW26_BAX-01       atcactc-----------------accatctgg-------------aaaaagatgggctg
M3XM76_BOK-01       ttcggtc---gcttcttgaaggccgccttct--tcctgctgttgccagagagatga----
M3XTL2_BAK1-01      ttctgtctgtggttctattgggccagtttgtggtacgaagattcttcaaatcgtga----
                     **  **                     * *                 *    **     

M3XW26_BAX-01       a
M3XM76_BOK-01       -
M3XTL2_BAK1-01      -
                     

© 1998-2018