Dataset for CDS BOK of Organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35425_BOK-02      atggaggtgctgcggcgctcttctgtctttgcagcggagatcatggacgcctttgatcgc
O35425_BOK-01      atggaggtgctgcggcgctcttctgtctttgcagcggagatcatggacgcctttgatcgc
                   ************************************************************

O35425_BOK-02      tcgcccacagacaaggagctggtggcccaggctaaggcactaggccgggagtacgtgcac
O35425_BOK-01      tcgcccacagacaaggagctggtggcccaggctaaggcactaggccgggagtacgtgcac
                   ************************************************************

O35425_BOK-02      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
O35425_BOK-01      gcgcggcttttgcgcgccggcctctcctggagcgctccagagcgtgcctcgcctgcccct
                   ************************************************************

O35425_BOK-02      ggaggacgcttggcagaggtgtgcacagtgctgctgcgcttgggagatgagctggagcag
O35425_BOK-01      ggaggacgcttggcagaggtgtgcacagtgctgctgcgcttgggagatgagctggagcag
                   ************************************************************

O35425_BOK-02      atccgtcccagcgtataccggaacgtggcccggcagctgcacatccccctgcagtcggag
O35425_BOK-01      atccgtcccagcgtataccggaacgtggcccggcagctgcacatccccctgcagtcggag
                   ************************************************************

O35425_BOK-02      cctgtggtgacggatgccttcctggcagtggcaggccacatcttctcagcaggtatcaca
O35425_BOK-01      cctgtggtgacggatgccttcctggcagtggcaggccacatcttctcagcaggtatcaca
                   ************************************************************

O35425_BOK-02      tggggcaaggtagtgtccctgtattccgtggccgcggggctagcggtggactgtgtccgg
O35425_BOK-01      tggggcaaggtagtgtccctgtattccgtggccgcggggctagcggtggactgtgtccgg
                   ************************************************************

O35425_BOK-02      caggctcagcctgccatggttcatgccctggttgactgcctgggggagtttgtacgcaag
O35425_BOK-01      caggctcagcctgccatggttcatgccctggttgactgcctgggggagtttgtacgcaag
                   ************************************************************

O35425_BOK-02      accttggctacctggcttcggaggcgtggtggatggacggatgtcctcaagtgtgtggtc
O35425_BOK-01      accttggctacctggcttcggaggcgtggtggatggacggatgtcctcaagtgtgtggtc
                   ************************************************************

O35425_BOK-02      agcacagatcctggcttccgctcccactggctcgtggccacgctctgcagctttggccgc
O35425_BOK-01      agcacagatcctggcttccgctcccactggctcgtggccacgctctgcagctttggccgc
                   ************************************************************

O35425_BOK-02      ttcctgaaggcagcattcttcctgttgttgccagagagatga
O35425_BOK-01      ttcctgaaggcagcattcttcctgttgttgccagagagatga
                   ******************************************

© 1998-2018