Dataset for CDS BAX-like of Organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q07813_BAX-01       atggacgggtccggggagcagcttgg--gagcggcgggcccaccagctctgaacagatca
Q07813_BAX-02       atggacgggtccggggagcagcttgg--gagcggcgggcccaccagctctgaacagatca
Q8K3J2_BAX-01       -----------------------------------------------------------a
O35425_BOK-02       atggaggtgctgcggcgctcttctgtctttgcagcgga------gatcatggacgcct-t
O35425_BOK-01       atggaggtgctgcggcgctcttctgtctttgcagcgga------gatcatggacgcct-t
O08734_BAK1-01      atgg---------------catctggacaaggaccaggtcccccgaaggtgggctgcg-a
O08734_BAK1-02      atgg---------------catctggacaaggaccaggtcccccgaaggtgggctgcg-a

Q07813_BAX-01       tgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctg
Q07813_BAX-02       tgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctg
Q8K3J2_BAX-01       tgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctg
O35425_BOK-02       tgatcgctcgcccacagacaa-ggagctggtggcccagg-----ctaaggcactaggccg
O35425_BOK-01       tgatcgctcgcccacagacaa-ggagctggtggcccagg-----ctaaggcactaggccg
O08734_BAK1-01      tgagtccccgtccccttctga-acagcaggttgcccaggac--acagaggaggtctttcg
O08734_BAK1-02      tgagtccccgtccccttctga-acagcaggttgcccaggac--acagaggaggtctttcg
                    ***   *  *  *           **    *   *****         **         *

Q07813_BAX-01       gggagac-----------------------acctgagctgaccttggagcagccgcccca
Q07813_BAX-02       gggagac-----------------------acctgagctgaccttggagcagccgcccca
Q8K3J2_BAX-01       gggagac-----------------------acctgagctgaccttggagcagccgcccca
O35425_BOK-02       ggagtacgt-------------------gcacgcgcggcttttgcgcgccggcctctcct
O35425_BOK-01       ggagtacgt-------------------gcacgcgcggcttttgcgcgccggcctctcct
O08734_BAK1-01      aagctacgttttttacctccaccagcaggaacaggagac--ccagggggcggccgcccct
O08734_BAK1-02      aagctacgttttttacctccaccagcaggaacaggagac--ccagggggcggccgcccct
                         **                       **  * *        *   * *** * ** 

Q07813_BAX-01       gga------------------tgcgtccaccaaga--------------------agctg
Q07813_BAX-02       gga------------------tgcgtccaccaaga--------------------agctg
Q8K3J2_BAX-01       gga------------------tgcgtccaccaaga--------------------agctg
O35425_BOK-02       ggagcgctccagagcgtgcctcgcctgcccctggaggacg-------cttggcagaggtg
O35425_BOK-01       ggagcgctccagagcgtgcctcgcctgcccctggaggacg-------cttggcagaggtg
O08734_BAK1-01      gccaaccccgaga---tggacaacttgcccctggaacccaacagcatcttgggtcaggtg
O08734_BAK1-02      gccaaccccgaga---tggacaacttgcccctggaacccaacagcatcttgggtcaggtg
                    *                      * * * **  **                    ** **

Q07813_BAX-01       agcgagtgtctccggcgaattggagatgaactgga------cagcaatatggagctgcag
Q07813_BAX-02       agcgagtgtctccggcgaattggagatgaactgga------cagcaatatggagctgcag
Q8K3J2_BAX-01       agcgagtgtctccggcgaattggagatgaactgga------cagcaatatggagctgcag
O35425_BOK-02       tgcacagtgctgctgcgcttgggagatgagctggagcagatcc----------gtcccag
O35425_BOK-01       tgcacagtgctgctgcgcttgggagatgagctggagcagatcc----------gtcccag
O08734_BAK1-01      ggtcggcagcttgctctcatcggagatgatattaaccggcgctacgacacagagttccag
O08734_BAK1-02      ggtcggcagcttgctctcatcggagatgatattaaccggcgctacgacacagagttccag
                     *       **    *   * ********  *  *      *           *   ***

Q07813_BAX-01       --------aggatgattgctgacgtggacacggactccccccga----------------
Q07813_BAX-02       --------aggatgattgctgacgtggacacggactccccccga----------------
Q8K3J2_BAX-01       --------aggatgattgctgacgtggacacggactccccccga----------------
O35425_BOK-02       cgtataccggaacg---tggcccggcagctgcacatccccctgcagtcggagcctgtggt
O35425_BOK-01       cgtataccggaacg---tggcccggcagctgcacatccccctgcagtcggagcctgtggt
O08734_BAK1-01      aatttactagaacagcttcagcccacagccgggaatgcctacgaactcttcacc------
O08734_BAK1-02      aatttactagaacagcttcagcccacagccgggaatgcctacgaactcttcacc------
                             * *          *     *      * **   *                 

Q07813_BAX-01       -gaggtcttcttccgggtggcagc--------tgacatgtttgctgatggcaacttcaac
Q07813_BAX-02       -gaggtcttcttccgggtggcagc--------tgacatgtttgctgatggcaacttcaac
Q8K3J2_BAX-01       -gaggtcttcttccgggtggcagc--------tgacatgtttgctgatggcaacttcaac
O35425_BOK-02       gacggatgccttcctggcagtggcagg-----ccacatcttctcagcaggta---tcaca
O35425_BOK-01       gacggatgccttcctggcagtggcagg-----ccacatcttctcagcaggta---tcaca
O08734_BAK1-01      -aagatcgcctc--------------------cagcctatttaagagtggca---tcagc
O08734_BAK1-02      -aagatcgcctccaggccagcagcaacatgcacagcctatttaagagtggca---tcagc
                       *     **                        * * **       ** *   ***  

Q07813_BAX-01       tggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgc
Q07813_BAX-02       tggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgc
Q8K3J2_BAX-01       tggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgc
O35425_BOK-02       tggggcaaggtagtgtccctgtattccgtggccgcggggctagcggtg--gactgtgtcc
O35425_BOK-01       tggggcaaggtagtgtccctgtattccgtggccgcggggctagcggtg--gactgtgtcc
O08734_BAK1-01      tggggccgcgtggtggctc-----tcctgggcttt--ggctaccgtct--ggccctgtac
O08734_BAK1-02      tggggccgcgtggtggctc-----tcctgggcttt--ggctaccgtct--ggccctgtac
                    ******   ** **  * *     * *   **       **   *     * *  *** *

Q07813_BAX-01       actaaagt--gcccgagctgatcagaacca----tcatgggctggacactggacttcc--
Q07813_BAX-02       actaaagt--gcccgagctgatcagaacca----tcatgggctggacactggacttcc--
Q8K3J2_BAX-01       actaaagt--gcccgagctgatcagaacca----tcatgggctggacactggacttcc--
O35425_BOK-02       ggcaggctcagcctg------------ccatggttcatgccctgg----ttgactgcctg
O35425_BOK-01       ggcaggctcagcctg------------ccatggttcatgccctgg----ttgactgcctg
O08734_BAK1-01      ----------gtcta------------cca----gcgtggtttga----ccggcttcctg
O08734_BAK1-02      ----------gtcta------------cca----gcgtggtttga---------------
                              * *              ***     * **   **                

Q07813_BAX-01       ----------------------------------tccgtgagcggctgcttgtctggatc
Q07813_BAX-02       ----------------------------------tccgtgagcggctgcttgtctggatc
Q8K3J2_BAX-01       ----------------------------------tccgtgagcggctgcttgtctggatc
O35425_BOK-02       ggggagtttg------------------------tacgcaagaccttggctacctggctt
O35425_BOK-01       ggggagtttg------------------------tacgcaagaccttggctacctggctt
O08734_BAK1-01      ggccaggtgacctgctttttggctgatatcatactgcatcattacatcgccagatggatc
O08734_BAK1-02      ------------------------------------------------------------

Q07813_BAX-01       caagaccagggtggctg----ggcctcctc--------------------tcctacttcg
Q07813_BAX-02       caagaccagggtggctgggaaggcctcctc--------------------tcctacttcg
Q8K3J2_BAX-01       caagaccagggtggctgggaaggcctcctc--------------------tcctacttcg
O35425_BOK-02       cggaggcgtggtggatggacggatgtcctcaagtgtgtggtcagcacagatcctggctt-
O35425_BOK-01       cggaggcgtggtggatggacggatgtcctcaagtgtgtggtcagcacagatcctggctt-
O08734_BAK1-01      gcacagagaggcggttgggtggcagccctgaatt------ttcgtagagaccccatcctg
O08734_BAK1-02      ------------------------------------------------------------

Q07813_BAX-01       ggacccccacatggcagacagtga------------------------------------
Q07813_BAX-02       ggacccccacatggcagacagtgaccatctt---tgtggctggagtcctcaccgcctcgc
Q8K3J2_BAX-01       ggacccccacatggcagacagtgaccatctt---tgtggctggagtcctcaccgcctcgc
O35425_BOK-02       ccgctcccac-tggctcgtggccacgctctgcagctttggccgcttcctgaaggcagcat
O35425_BOK-01       ccgctcccac-tggctcgtggccacgctctgcagctttggccgcttcctgaaggcagcat
O08734_BAK1-01      accgtaatgg-tgatttttggtgtggttctg----ttgggccaattcgtggtacacagat
O08734_BAK1-02      ------------------------------------------------------------

Q07813_BAX-01       --------------------------
Q07813_BAX-02       tcaccatctggaagaagatgggctga
Q8K3J2_BAX-01       tcaccatctggaagaagatgggctga
O35425_BOK-02       tcttcctgttgttgccagagagatga
O35425_BOK-01       tcttcctgttgttgccagagagatga
O08734_BAK1-01      tcttcagatc------------atga
O08734_BAK1-02      --------------------------

© 1998-2019