Dataset for CDS BAX of Organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q07813_BAX-01      atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatg
Q07813_BAX-02      atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatg
Q8K3J2_BAX-01      ---------------------------------------------------------atg

Q07813_BAX-01      aagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggg
Q07813_BAX-02      aagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggg
Q8K3J2_BAX-01      aagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggg

Q07813_BAX-01      gagacacctgagctgaccttggagcagccgccccaggatgcgtccaccaagaagctgagc
Q07813_BAX-02      gagacacctgagctgaccttggagcagccgccccaggatgcgtccaccaagaagctgagc
Q8K3J2_BAX-01      gagacacctgagctgaccttggagcagccgccccaggatgcgtccaccaagaagctgagc

Q07813_BAX-01      gagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
Q07813_BAX-02      gagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
Q8K3J2_BAX-01      gagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt

Q07813_BAX-01      gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgttt
Q07813_BAX-02      gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgttt
Q8K3J2_BAX-01      gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgttt

Q07813_BAX-01      gctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactg
Q07813_BAX-02      gctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactg
Q8K3J2_BAX-01      gctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactg

Q07813_BAX-01      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca
Q07813_BAX-02      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca
Q8K3J2_BAX-01      gtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggaca

Q07813_BAX-01      ctggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctg----ggc
Q07813_BAX-02      ctggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggaaggc
Q8K3J2_BAX-01      ctggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggaaggc
                   *****************************************************    ***

Q07813_BAX-01      ctcctctcctacttcgggacccccacatggcagacagtga--------------------
Q07813_BAX-02      ctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtc
Q8K3J2_BAX-01      ctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtc

Q07813_BAX-01      ---------------------------------------
Q07813_BAX-02      ctcaccgcctcgctcaccatctggaagaagatgggctga
Q8K3J2_BAX-01      ctcaccgcctcgctcaccatctggaagaagatgggctga

© 1998-2019