Dataset for CDS BAK1 of Organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O08734_BAK1-01      atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtcccct
O08734_BAK1-02      atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtcccct
                    ************************************************************

O08734_BAK1-01      tctgaacagcaggttgcccaggacacagaggaggtctttcgaagctacgttttttacctc
O08734_BAK1-02      tctgaacagcaggttgcccaggacacagaggaggtctttcgaagctacgttttttacctc
                    ************************************************************

O08734_BAK1-01      caccagcaggaacaggagacccagggggcggccgcccctgccaaccccgagatggacaac
O08734_BAK1-02      caccagcaggaacaggagacccagggggcggccgcccctgccaaccccgagatggacaac
                    ************************************************************

O08734_BAK1-01      ttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
O08734_BAK1-02      ttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
                    ************************************************************

O08734_BAK1-01      gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagccc
O08734_BAK1-02      gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagccc
                    ************************************************************

O08734_BAK1-01      acagccgggaatgcctacgaactcttcaccaagatcgcctc-------------------
O08734_BAK1-02      acagccgggaatgcctacgaactcttcaccaagatcgcctccaggccagcagcaacatgc
                    *****************************************                   

O08734_BAK1-01      -cagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct
O08734_BAK1-02      acagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct
                     ***********************************************************

O08734_BAK1-01      accgtctggccctgtacgtctaccagcgtggtttgaccggcttcctgggccaggtgacct
O08734_BAK1-02      accgtctggccctgtacgtctaccagcgtggtttga------------------------
                    ************************************                        

O08734_BAK1-01      gctttttggctgatatcatactgcatcattacatcgccagatggatcgcacagagaggcg
O08734_BAK1-02      ------------------------------------------------------------
                                                                                

O08734_BAK1-01      gttgggtggcagccctgaattttcgtagagaccccatcctgaccgtaatggtgatttttg
O08734_BAK1-02      ------------------------------------------------------------
                                                                                

O08734_BAK1-01      gtgtggttctgttgggccaattcgtggtacacagattcttcagatcatga
O08734_BAK1-02      --------------------------------------------------
                                                                      

© 1998-2018