Dataset for CDS BAK1 of Organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O08734_BAK1-01      atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtcccct
O08734_BAK1-02      atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtcccct

O08734_BAK1-01      tctgaacagcaggttgcccaggacacagaggaggtctttcgaagctacgttttttacctc
O08734_BAK1-02      tctgaacagcaggttgcccaggacacagaggaggtctttcgaagctacgttttttacctc

O08734_BAK1-01      caccagcaggaacaggagacccagggggcggccgcccctgccaaccccgagatggacaac
O08734_BAK1-02      caccagcaggaacaggagacccagggggcggccgcccctgccaaccccgagatggacaac

O08734_BAK1-01      ttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
O08734_BAK1-02      ttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga

O08734_BAK1-01      gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagccc
O08734_BAK1-02      gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagccc

O08734_BAK1-01      acagccgggaatgcctacgaactcttcaccaagatcgcctc-------------------
O08734_BAK1-02      acagccgggaatgcctacgaactcttcaccaagatcgcctccaggccagcagcaacatgc

O08734_BAK1-01      -cagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct
O08734_BAK1-02      acagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct

O08734_BAK1-01      accgtctggccctgtacgtctaccagcgtggtttgaccggcttcctgggccaggtgacct
O08734_BAK1-02      accgtctggccctgtacgtctaccagcgtggtttga------------------------

O08734_BAK1-01      gctttttggctgatatcatactgcatcattacatcgccagatggatcgcacagagaggcg
O08734_BAK1-02      ------------------------------------------------------------

O08734_BAK1-01      gttgggtggcagccctgaattttcgtagagaccccatcctgaccgtaatggtgatttttg
O08734_BAK1-02      ------------------------------------------------------------

O08734_BAK1-01      gtgtggttctgttgggccaattcgtggtacacagattcttcagatcatga
O08734_BAK1-02      --------------------------------------------------

© 1998-2019