Dataset for CDS BAX-like of Organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6R4F6_BAK1-01      atggc-----------------------ttctaggc--aggtgaaccgggttcgagcccc
F6XQQ4_BAX-01       atggacggctccggagagcagc------cgcgaggcgggggtgatctggggg--------
F7G9S0_BOK-01       atgga-ggttctgcggcgctcctcggtgttcgcggcggaggtgatggaagtgtttgaccg
                    ****                          *  ***   *****     *          

F6R4F6_BAK1-01      atcatctactgcagaggaacaggtggcccgagagactgaagaggtttt---ccgaagcta
F6XQQ4_BAX-01       -----ccacaagctcggagcagatcatgag---gaccggagccgtgctgctgcaggggtt
F7G9S0_BOK-01       ctctcccaccgacaaagagctcgtgtccca---ggccaaagcc---ctgggccgggaata
                         * **       ** *   *         * *   **      *    *     * 

F6R4F6_BAK1-01      tgtctactaccgccaccaacaagagcaggaaactgagggagaagctgtccctgcagaccc
F6XQQ4_BAX-01       tatccaggaccgggcgggccgag----------tggcggggggtgcccccgagctgctcc
F7G9S0_BOK-01       catccactcccggctcatccggg-------------------------ccggcctggtct
                      ** *   ***       *  *                         **   * *  * 

F6R4F6_BAK1-01      agagatggataccctaccccaagagctcagcagcaccacc------------gagcaggt
F6XQQ4_BAX-01       tgga---------ctccatgggggactcggccccgctgccttcagaccccaggaccaagc
F7G9S0_BOK-01       ggag---------caaacccgaggccaagaccccgacgcctggcg-----ggaagctggc
                     *           *        *  *    *  *    **             * *  * 

F6R4F6_BAK1-01      gg-----gccgacagcttgccgt-catcggggatgacatcagtcgtaggtatgactcaga
F6XQQ4_BAX-01       ggc--ttaccgagtgcctgcggaggatcggggacg--agctgg-----------------
F7G9S0_BOK-01       ggaggtggccagcatccttctgcggctgggggatg--agctggagtacatcaggcccaac
                    **      **     * * * *    * ***** *  * * *                  

F6R4F6_BAK1-01      attcaaggc--catgctgcagcatttgcagcccaccc---------------------cc
F6XQQ4_BAX-01       ----acagcaacatggagcttcagaggatgatcgccgcg------------gtggagacc
F7G9S0_BOK-01       gtctaccggaacattgctcgccagctgaacatctccctacagtctgagagtgtggtgacc
                        *  *   ***    *  **   *     * **                      **

F6R4F6_BAK1-01      gacactgcctatgagtacttcaccaagatcgcctccagcctgtttgagagcggca---tc
F6XQQ4_BAX-01       gactccccccgggaggtgttcttccgagtggcagccgagatgttttccgatgggaacttc
F7G9S0_BOK-01       gacgccttcctgg----------cc--gtggccacgcagatcttcgcagcaggaa----t
                    *** *   *   *          *    * **  *     * **       ** *     

F6R4F6_BAK1-01      aactggggccgagtggtggcc--ctgctgggctttggctacc-ggttggcact--acatg
F6XQQ4_BAX-01       aactgggggcgggtggtggccctcttctat--tttgccagca-agctggtgctcaaggcg
F7G9S0_BOK-01       aacatggggcaa--agtggtctccctctatgccgtggcagcagggctggcagt--ggact
                    ***  *** *     **** *  *  **      ** *  *   * ***   *       

F6R4F6_BAK1-01      tttatcagcggggcctgaccggcttcctgggccga---gtggctcactttgtggctgatt
F6XQQ4_BAX-01       ctttgcaccaaggtc---ccgga--gctgatccgaaccatagtgggctggaccctagatt
F7G9S0_BOK-01       gtgtgaagcaggcccag-ccagc--catggtccacaccatcgtggactgcctgggagagt
                     *    * *  *  *   ** *     **  **      * *    **        ** *

F6R4F6_BAK1-01      tcatgctccatcactgcattgcccgctggattgcccagaatgggggctgggtggcagccc
F6XQQ4_BAX-01       tcttgagagaac----ggctgctcacctggat--ccaggaacagggtggctgggacggcc
F7G9S0_BOK-01       ttgtacgcaaga----cgctggtgacttggct--caagaggcgaggaggatgggcagaca
                    *  *     *         **    *  *  *  * **      **  *   **  * * 

F6R4F6_BAK1-01      tgaacct-----------caccaacaactctatcttgtacgtggtgaca-----------
F6XQQ4_BAX-01       tcctctcttacttcgggacaccaa-----ct---tggcagacagtgacc----------a
F7G9S0_BOK-01       t-----------------catgaa-----gtgtgtggtggacagtgaccccagccttcga
                    *                 **  **      *   * *      *****            

F6R4F6_BAK1-01      ---------gtcttgggtgtggtcctc---tttgttcgcttcttgatccgaagatt----
F6XQQ4_BAX-01       tc-------ttcgtggctggcatcctca-------ccgcttcc-----------------
F7G9S0_BOK-01       tcgcactggctcgtggccgccctctgcagcttcggccacttcctgaaggccatcttcttt
                              ** ***  *   **  *         * ****                  

F6R4F6_BAK1-01      --cttccaaccttga-----------
F6XQQ4_BAX-01       --cttaccatctggaagatgtcctag
F7G9S0_BOK-01       gtcctgctgccagagagatga-----
                      * * *   *               

© 1998-2019