Dataset for CDS BAX-like of Organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7QEC1_BOK-01       atgg----------aggtgctgcggcgctcttctgtctttgctgcggaga
A0A1U7R0G7_BAK1-01      atggcatctggacaaggaccag----gccctcct----------------
                        ****          ***  * *    ** ** **                

A0A1U7QEC1_BOK-01       tcatggacgcctttgatcgctcgc---ccacagacaaggagctggtggcc
A0A1U7R0G7_BAK1-01      --agggaggactgtgatgactccccctccccttctgaacagcaggtcgcc
                          * *** * ** ****  *** *   ** *     *  *** *** ***

A0A1U7QEC1_BOK-01       caggccaaggcactaggccgggagtacgtgcacgcgcggcttttgcgcgc
A0A1U7R0G7_BAK1-01      caggacacag--------aggaggtctttcgaagctatgttttt---cac
                        **** **  *         **  **   *  * **   * ****   * *

A0A1U7QEC1_BOK-01       cggcctctcctggagc----gcaccagagcgta-----cttcgcctgccc
A0A1U7R0G7_BAK1-01      ctccaccagcaggagcaagagacccagggggcggctgcctctgccaaccc
                        *  *  *  * *****    *  **** * *       **  ***  ***

A0A1U7QEC1_BOK-01       ctgga-ggacggctagc-----------------------------ggag
A0A1U7R0G7_BAK1-01      cgagatggacaacttgctcctagaacccaacagcgtcttgggtcaagtgg
                        *  ** ****  ** **                             *  *

A0A1U7QEC1_BOK-01       gtgtgcaccgtgctgctgcgcttgggggatgagctgga--gcagatccgt
A0A1U7R0G7_BAK1-01      gtcggcagcttgctat----cattggagacgacattaaccggagatacga
                        **  *** * ****      * * ** ** **  *  *  * **** ** 

A0A1U7QEC1_BOK-01       cccagtgtgtaccgcaacgtggccgggcagctgcgcatctccctgcagtc
A0A1U7R0G7_BAK1-01      cacagagtt--ccagaacttactggagcagctgc----------------
                        * *** **   **  *** *    * ********                

A0A1U7QEC1_BOK-01       tgagcctgtggtgactgacgcct------tccttgctgtggcaggccaca
A0A1U7R0G7_BAK1-01      --agcccacagcggggaatgcctacgagctcttcaccaagatcgcttcca
                          ****    * *    * ****      ** *  *   *   *    **

A0A1U7QEC1_BOK-01       tcttctc---agctggcatcacatggggcaaggtggtgtc---cctgtac
A0A1U7R0G7_BAK1-01      gcctatttaagagtggcatcagctggggccgtgtggtggctctcctgggc
                         * * *       ********  ******   ****** *   ****  *

A0A1U7QEC1_BOK-01       tcggtggctgcggggctggctgtggactgcgttcggcaggctcagcctgc
A0A1U7R0G7_BAK1-01      tt--tggctac-cgcctggccctgtac-----------------gtctac
                        *   ***** *  * *****  ** **                 * ** *

A0A1U7QEC1_BOK-01       catggttcatgccctggttgactgcctgggggaatttgtgcgcaagaccc
A0A1U7R0G7_BAK1-01      ca----gcgtggcttgaccggcttcctggg------------------cc
                        **     * ** * **   * ** ******                  **

A0A1U7QEC1_BOK-01       tggcgacctggcttcggaggcgtggcgga--------tggaccg--atgt
A0A1U7R0G7_BAK1-01      aggtgacctgctttt-------tggctgatatcatactgcaccattatat
                         ** ******  **        **** **        ** ***   ** *

A0A1U7QEC1_BOK-01       cctcaagtgtgtggtcagcacagaccctggcttccgctcccactggctgg
A0A1U7R0G7_BAK1-01      cgccaggtg---gatc-gcacaga-----------gaggcggctgggtgg
                        *  ** ***   * ** *******           *   *  **** ***

A0A1U7QEC1_BOK-01       tggccacg-ctctacagttttggccgcttcctgaaggctgc----attct
A0A1U7R0G7_BAK1-01      cagccctgaatctgc-gtagagaccccatcctgagtgtggtgacaattct
                          ***  *  *** * **   * ** * ******  *  *     *****

A0A1U7QEC1_BOK-01       tcctgttgtt-------gccagag-------------------aga---t
A0A1U7R0G7_BAK1-01      cggtgtggttctgttgggccagtacgtggtacacaagttcttcagatcct
                           *** ***       *****                     ***   *

A0A1U7QEC1_BOK-01       ga
A0A1U7R0G7_BAK1-01      ga
                        **

© 1998-2018