Dataset for CDS BAX-like of Organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1MWK7_BOK-01       gcaccctctcttctttt---------------cccaggcataacatggggcaaggtggtt
H9H1N7_BAK1-02      gggac------ccacccaggggcccacggacgccggggcagcaatgggcgcaggccg---
H9H1N7_BAK1-01      gtggcctctttccaacctgggg------------aaagcagcagc-----caagctg---
                    *   *       *                        ***  *       ** *  *   

G1MWK7_BOK-01       tctctcta--------------cgctgtggcagcggggctgg-----cagtggactgtgt
H9H1N7_BAK1-02      tcacgaga--------------gaccaattcagaggaccaggtggcccagcagaccgagg
H9H1N7_BAK1-01      cccctctacttctctcccccttgcctctctcagaggaccaggtggcccagcagaccgagg
                     * *   *                *     *** **  * **     ***  *** * * 

G1MWK7_BOK-01       gcgtcatgcacagccagccatggtccac----accatc--------gtggactgcctggg
H9H1N7_BAK1-02      aggtgttccggagcta--caccttctaccgctaccagcaggagagagaggagggagggga
H9H1N7_BAK1-01      aggtgttccggagcta--caccttctaccgctaccagcaggagagagaggagggagggga
                      **  * *  *** *  **   ** **    **** *        * ***  *   ** 

G1MWK7_BOK-01       agagt------ttgtccgcaagaccttggtgacgtggctgaagaggcgaggaggctgggc
H9H1N7_BAK1-02      agaggtgcccatggacccggagatcatggagatccagc--aggagctgggcagcatcggg
H9H1N7_BAK1-01      agaggtgcccatggacccggagatcatggagatccagc--aggagctgggcagcatcggg
                    ****       * * **   *** * *** **    **  * ***  * * **  * ** 

G1MWK7_BOK-01       agaca--tcaccaagtgcgtggtcagcaccgaccccagtctccgctcccactggctcgtg
H9H1N7_BAK1-02      agccaggtgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcg
H9H1N7_BAK1-01      agccaggtgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcg
                    ** **  *   ** * ** *** ** ** **    *    **  *   *  *    ** *

G1MWK7_BOK-01       g----ccgccatctgcag-----------------------------ctttgggcacttc
H9H1N7_BAK1-02      gagttccgccatatgctgaagtcattgcagcccaccaaggagaatgcctacgagtacttc
H9H1N7_BAK1-01      gagttccgccatatgctgaagtcattgcagcccaccaaggagaatgcctacgagtacttc
                    *    ******* *** *                             **  * * *****

G1MWK7_BOK-01       ctcaaggccatcttcttc------------------------------------------
H9H1N7_BAK1-02      acca---ccatagcctcc------------------------------------------
H9H1N7_BAK1-01      acca---ccatagcctccagtcaccgtccccttggcagcccttgcacgagctgtctgggg
                      **   ****   ** *                                          

G1MWK7_BOK-01       -----------------------------gtgttgctgcccgagaga-------------
H9H1N7_BAK1-02      ------------------------------------------------------------
H9H1N7_BAK1-01      gcagaagctttgggttgggaagcgtggccaagtggatgtcccagcaacagtgtgaagact
                                                                                

G1MWK7_BOK-01       ---
H9H1N7_BAK1-02      ---
H9H1N7_BAK1-01      gga
                       

© 1998-2018