Dataset for CDS BAK1 of Organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H9H1N7_BAK1-02      gggac------ccacccaggggcccacggacgccggggcagcaatgggcgcaggccgtca
H9H1N7_BAK1-01      gtggcctctttccaacctgggg------------aaagcagcagc-----caagctgccc
                    * * *      *** ** ****               ******       ** ** * * 

H9H1N7_BAK1-02      cgaga--------------gaccaattcagaggaccaggtggcccagcagaccgaggagg
H9H1N7_BAK1-01      ctctacttctctcccccttgcctctctcagaggaccaggtggcccagcagaccgaggagg
                    *   *              * *    **********************************

H9H1N7_BAK1-02      tgttccggagctacaccttctaccgctaccagcaggagagagaggagggaggggaagagg
H9H1N7_BAK1-01      tgttccggagctacaccttctaccgctaccagcaggagagagaggagggaggggaagagg

H9H1N7_BAK1-02      tgcccatggacccggagatcatggagatccagcaggagctgggcagcatcgggagccagg
H9H1N7_BAK1-01      tgcccatggacccggagatcatggagatccagcaggagctgggcagcatcgggagccagg

H9H1N7_BAK1-02      tgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcggagttcc
H9H1N7_BAK1-01      tgggcaggcgcctggccatcatcggggacgacatcaacaagcggtacgacgcggagttcc

H9H1N7_BAK1-02      gccatatgctgaagtcattgcagcccaccaaggagaatgcctacgagtacttcaccacca
H9H1N7_BAK1-01      gccatatgctgaagtcattgcagcccaccaaggagaatgcctacgagtacttcaccacca

H9H1N7_BAK1-02      tagcctcc----------------------------------------------------
H9H1N7_BAK1-01      tagcctccagtcaccgtccccttggcagcccttgcacgagctgtctgggggcagaagctt

H9H1N7_BAK1-02      -----------------------------------------------------
H9H1N7_BAK1-01      tgggttgggaagcgtggccaagtggatgtcccagcaacagtgtgaagactgga

© 1998-2019