Dataset for CDS BAX-like of Organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5XKG3_BAX-04       atgg--------------------------acgggtccggggagcagccc
A0A2K5XKG3_BAX-03       atgg--------------------------acgggtccggggagcagccc
A0A2K5XKG3_BAX-01       atgg--------------------------acgggtccggggagcagccc
A0A2K5XKG3_BAX-02       atgg--------------------------acgggtccggggagcagccc
A0A2K5YX79_BOK-01       atgcgcagggaactggccaatgggaatgtcctggccccagcagagacacc
A0A2K5YIY6_BAK1-01      ------------------------------atggcatcagggcaaggccc
A0A2K5YIY6_BAK1-02      ------------------------------atggcatcagggcaaggccc
A0A2K5YT59_BAK1-02      ------------------------------atggcttcgggacaaggccc
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      ------------------------------atggcttcgggacaaggccc

A0A2K5XKG3_BAX-04       ag------------------aggcgggg----------------------
A0A2K5XKG3_BAX-03       ag------------------aggcgggg----------------------
A0A2K5XKG3_BAX-01       ag------------------aggcgggg----------------------
A0A2K5XKG3_BAX-02       ag------------------aggcgggg----------------------
A0A2K5YX79_BOK-01       aggctctgatctaactcagaacgccggactccctcagagcgccgcagccc
A0A2K5YIY6_BAK1-01      agggttt--cccaagcaggagtgcggag----------------------
A0A2K5YIY6_BAK1-02      agggttt--cccaagcaggagtgcggag----------------------
A0A2K5YT59_BAK1-02      aggtcct--cccaggcaggaatgcggag----------------------
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      aggtcct--cccaggcaggaatgcggag----------------------

A0A2K5XKG3_BAX-04       ----------------g---gcccaccagctct-------------gaac
A0A2K5XKG3_BAX-03       ----------------gagtgacaccccgttct-------------ga--
A0A2K5XKG3_BAX-01       ----------------g---gcccaccagctct-------------gaac
A0A2K5XKG3_BAX-02       ----------------g---gcccaccagctct-------------gaac
A0A2K5YX79_BOK-01       atctcttgcacccgcagcacgccctgca-ctccagaggcttcctgcgagc
A0A2K5YIY6_BAK1-01      ---------------agcttgccctgcc-ctct----gcttctgaggagc
A0A2K5YIY6_BAK1-02      ---------------agcttgccctgcc-ctct----gcttctgaggagc
A0A2K5YT59_BAK1-02      ---------------agcctgccctgcc-ctct----gcttctgaggagc
A0A2K5YT59_BAK1-03      ----------------------------------------------gagc
A0A2K5YT59_BAK1-01      ---------------agcctgccctgcc-ctct----gcttctgaggagc

A0A2K5XKG3_BAX-04       ag------------------------------------------------
A0A2K5XKG3_BAX-03       --------------------------------------------------
A0A2K5XKG3_BAX-01       ag------------------------------------------------
A0A2K5XKG3_BAX-02       ag------------------------------------------------
A0A2K5YX79_BOK-01       tgcatgtgttcggccccacctagttcctctggcctgtccacgccgtgccg
A0A2K5YIY6_BAK1-01      ag------------------------------------------------
A0A2K5YIY6_BAK1-02      ag------------------------------------------------
A0A2K5YT59_BAK1-02      ag------------------------------------------------
A0A2K5YT59_BAK1-03      ag------------------------------------------------
A0A2K5YT59_BAK1-01      ag------------------------------------------------

A0A2K5XKG3_BAX-04       -----------------------------------------atcatgaag
A0A2K5XKG3_BAX-03       --------------------------------------------------
A0A2K5XKG3_BAX-01       -----------------------------------------atcatgaag
A0A2K5XKG3_BAX-02       -----------------------------------------atcatgaag
A0A2K5YX79_BOK-01       tgccggtccacaccctgtccagcccactcaaaccatccacacccctgtac
A0A2K5YIY6_BAK1-01      --------------------------------------gtaacccgggac
A0A2K5YIY6_BAK1-02      --------------------------------------gtaacccgggac
A0A2K5YT59_BAK1-02      --------------------------------------gtagcccgggac
A0A2K5YT59_BAK1-03      --------------------------------------gtagcccgggac
A0A2K5YT59_BAK1-01      --------------------------------------gtagcccgggac

A0A2K5XKG3_BAX-04       acaggggccctttt----------gcttcagggtttcatccaggatcgag
A0A2K5XKG3_BAX-03       ----------ttct----------gcaccctcactccatccccactcta-
A0A2K5XKG3_BAX-01       acaggggccctttt----------gcttcagggtttcatccaggatcgag
A0A2K5XKG3_BAX-02       acaggggccctttt----------gcttcagg------------------
A0A2K5YX79_BOK-01       acactgacagctcagggccgctccg-gcctggtcgccttctccgggcgca
A0A2K5YIY6_BAK1-01      atggagaag---------------gtttttgaccgccatcagcagg----
A0A2K5YIY6_BAK1-02      atggagaag---------------gtttttgaccgccatcagcagg----
A0A2K5YT59_BAK1-02      acagaggaggttttccgcagctacgttttttaccgccatcagcaga----
A0A2K5YT59_BAK1-03      acagaggaggttttccgcagctacgttttttaccgccatcagcagg----
A0A2K5YT59_BAK1-01      acagaggaggttttccgcagctacgttttttaccgccatcagcagg----

A0A2K5XKG3_BAX-04       cagggcg--------------------aatgggggg--------------
A0A2K5XKG3_BAX-03       ---ggcg--------------------aatgggggg--------------
A0A2K5XKG3_BAX-01       cagggcg--------------------aatgggggg--------------
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       tccagggaactcgctcggtcctccttaagcgggaggcgatcttaattagt
A0A2K5YIY6_BAK1-01      ---------------------------aacaggaggct------------
A0A2K5YIY6_BAK1-02      ---------------------------aacaggaggct------------
A0A2K5YT59_BAK1-02      ---------------------------acc--------------------
A0A2K5YT59_BAK1-03      ---------------------------aacaggaggct------------
A0A2K5YT59_BAK1-01      ---------------------------aacaggaggct------------

A0A2K5XKG3_BAX-04       --------------------------------------------------
A0A2K5XKG3_BAX-03       --------------------------------------------------
A0A2K5XKG3_BAX-01       --------------------------------------------------
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       gagatccagagcagctggctccggggaggggatgagggcgcctttatcgg
A0A2K5YIY6_BAK1-01      --------------------------------------------------
A0A2K5YIY6_BAK1-02      --------------------------------------------------
A0A2K5YT59_BAK1-02      --------------------------------------------------
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      --------------------------------------------------

A0A2K5XKG3_BAX-04       ---ggagacacc------------------------------cgagctgg
A0A2K5XKG3_BAX-03       ---ggagacacc------------------------------cgagctgg
A0A2K5XKG3_BAX-01       ---ggagacacc------------------------------cgagctgg
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       ccagaatggtccgctttctctgcccagcccctccccacgtcgggctctgg
A0A2K5YIY6_BAK1-01      ---gaagggccagccgcccctgccgaccc-------------agagatgg
A0A2K5YIY6_BAK1-02      ---gaagg------------------------------------------
A0A2K5YT59_BAK1-02      --------------------------------------------------
A0A2K5YT59_BAK1-03      ---gaaggggcggctgcccctgctgatcc-------------agagatgg
A0A2K5YT59_BAK1-01      ---gaaggggcggctgcccctgctgatcc-------------agagatgg

A0A2K5XKG3_BAX-04       ccctggacccggtgcctcaggatgcgtccaccaaga---------ggctg
A0A2K5XKG3_BAX-03       ccctggacccggtgcctcaggatgcgtccaccaaga---------ggctg
A0A2K5XKG3_BAX-01       ccctggacccggtgcctcaggatgcgtccaccaaga---------ggctg
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       ccgcctgcctggtccctcctgctctgggcagctcgactgcctgtcggctg
A0A2K5YIY6_BAK1-01      tcacct------t---------------cagcaccg------------tg
A0A2K5YIY6_BAK1-02      ----------------------------cagcaccg------------tg
A0A2K5YT59_BAK1-02      --------------cctctgccac------gagcca-------------a
A0A2K5YT59_BAK1-03      acacct------tgcccctgcaacctagcagcacca------------tg
A0A2K5YT59_BAK1-01      acacct------tgcccctgcaacctagcagcacca------------tg

A0A2K5XKG3_BAX-04       agcgag--------------------tgtctcaagcgcatcggggacgaa
A0A2K5XKG3_BAX-03       agcgag--------------------tgtctcaagcgcatcggggacgaa
A0A2K5XKG3_BAX-01       agcgag--------------------tgtctcaagcgcatcggggacgaa
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       ggccaaggttgggggacggctcaagggaggtc-----------agatggg
A0A2K5YIY6_BAK1-01      gggcag----gtgggacggc-------ggatc------------------
A0A2K5YIY6_BAK1-02      gggcag----gtgggacggc-------ggatc------------------
A0A2K5YT59_BAK1-02      ggcctg----gtgggacggc-------agctcgccatcatcggggacgac
A0A2K5YT59_BAK1-03      gggcag----gtgggacggc-------agctcgccatcatcggggacgac
A0A2K5YT59_BAK1-01      gggcag----gtgggacggc-------agctcgccatcatcggggacgac

A0A2K5XKG3_BAX-04       ctggacagtaacatgga-------------------------gctgcag-
A0A2K5XKG3_BAX-03       ctggacagtaacatgga-------------------------gctgcag-
A0A2K5XKG3_BAX-01       ctggacagtaacatgga-------------------------gctgcag-
A0A2K5XKG3_BAX-02       --------------------------------------------------
A0A2K5YX79_BOK-01       gttaagtggaggtgggaatcagacaagttaagtcaggaacaggccggaat
A0A2K5YIY6_BAK1-01      -------------------------------------accatgctgcac-
A0A2K5YIY6_BAK1-02      -------------------------------------accatgctgcac-
A0A2K5YT59_BAK1-02      atcaaccgacgctatgactcag-------agttccagaccatgctgcag-
A0A2K5YT59_BAK1-03      atcaaccgacgctatgactcag-------agttccagaccatgctgcag-
A0A2K5YT59_BAK1-01      atcaaccgacgctatgactcag-------agttccagaccatgctgcag-

A0A2K5XKG3_BAX-04       -------aggatgattgccgccgtggacacagactccccccgagaggtct
A0A2K5XKG3_BAX-03       -------aggatgattgccgccgtggacacagactccccccgagaggtct
A0A2K5XKG3_BAX-01       -------aggatgattgccgccgtggacacagactccccccgagaggtct
A0A2K5XKG3_BAX-02       --------ggatgattgccgccgtggacacagactccccccgagaggtct
A0A2K5YX79_BOK-01       tcaagcagggtcaggtggggtcaggtgcagggtgtgccccaagccagttg
A0A2K5YIY6_BAK1-01      -----------cacctgcagcccacagcagagaacgcct---acgagtac
A0A2K5YIY6_BAK1-02      -----------cacctgcagcccacagcagagaacgcct---acgagtac
A0A2K5YT59_BAK1-02      -----------cagctgcagcccacggcagagaacgcct---atgagtac
A0A2K5YT59_BAK1-03      -----------cagctgcagcccacggcagagaacgcct---atgagtac
A0A2K5YT59_BAK1-01      -----------cagctgcagcccacggcagagaacgcct---atgagtac
                                       **  * *     **  *    **        **  

A0A2K5XKG3_BAX-04       ttttcc---------------gagtggcagc-----------------tg
A0A2K5XKG3_BAX-03       ttttcc---------------gagtggcagc-----------------tg
A0A2K5XKG3_BAX-01       ttttcc---------------gagtggcagc-----------------tg
A0A2K5XKG3_BAX-02       ttttcc---------------gagtggcagc-----------------tg
A0A2K5YX79_BOK-01       tgtcccagggagctggggcgtgggctgtctc-----------------tc
A0A2K5YIY6_BAK1-01      ttcacca--------------agatcgcctc-------------------
A0A2K5YIY6_BAK1-02      ttcacca--------------agatcgcctc-------------------
A0A2K5YT59_BAK1-02      ttcacca--------------agattgcctc-------------------
A0A2K5YT59_BAK1-03      ttcacca--------------agattgcctccaggccagcagcaacaccc
A0A2K5YT59_BAK1-01      ttcacca--------------agattgcctc-------------------
                        *   **                    *   *                   

A0A2K5XKG3_BAX-04       acatgttttctga----cggcaacttcaactgggg---------------
A0A2K5XKG3_BAX-03       acatgttttctga----cggcaacttcaactgggg---------------
A0A2K5XKG3_BAX-01       acatgttttctga----cggcaacttcaactgggg---------------
A0A2K5XKG3_BAX-02       acatgttttctga----cggcaacttcaactgggg---------------
A0A2K5YX79_BOK-01       actgcctttgtgaccacacaggggatgagctggagatgatccgacccagc
A0A2K5YIY6_BAK1-01      -cagcctgtttga----gagtggcatcaaccaggg---------------
A0A2K5YIY6_BAK1-02      -cagcctgtttga----gagtggcatcaaccaggg---------------
A0A2K5YT59_BAK1-02      -cagcctgtttga----gagtggcatcaactgggg---------------
A0A2K5YT59_BAK1-03      acagcctgtttga----gagtggcatcaactgggg---------------
A0A2K5YT59_BAK1-01      -cagcctgtttga----gagtggcatcaactgggg---------------
                         *    * * ***            * * *  * *               

A0A2K5XKG3_BAX-04       -----ccgtgttgtcgcccttttc-----------------------tac
A0A2K5XKG3_BAX-03       -----ccgtgttgtcgcccttttc-----------------------tac
A0A2K5XKG3_BAX-01       -----ccgtgttgtcgcccttttc-----------------------tac
A0A2K5XKG3_BAX-02       -----ccgtgttgtcgcccttttc-----------------------tac
A0A2K5YX79_BOK-01       gtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcc
A0A2K5YIY6_BAK1-01      -----ccgtgtggtggctctcctg-----------------------ggc
A0A2K5YIY6_BAK1-02      -----ccgtgtggtggctctcctg-----------------------ggc
A0A2K5YT59_BAK1-02      -----ccgtgtggtggctcttctg-----------------------ggc
A0A2K5YT59_BAK1-03      -----ccgtgtggtggctcttctg-----------------------ggc
A0A2K5YT59_BAK1-01      -----ccgtgtggtggctcttctg-----------------------ggc
                             ***    ** ** *                              *

A0A2K5XKG3_BAX-04       tttgccagcaa-------actggtgctc-aaggccctgtgtac-------
A0A2K5XKG3_BAX-03       tttgccagcaa-------actggtgctc-aaggccctgtgtac-------
A0A2K5XKG3_BAX-01       tttgccagcaa-------actggtgctc-aaggccctgtgtac-------
A0A2K5XKG3_BAX-02       tttgccagcaa-------actggtgctc-aaggccctgtgtac-------
A0A2K5YX79_BOK-01       tgtggtgaccgatgcgttcctggccgtggctggccacatcttctctgcag
A0A2K5YIY6_BAK1-01      ttcggctaccg-------tctggcccta------catgtctac-------
A0A2K5YIY6_BAK1-02      ttcggctaccg-------tctggcccta------catgtctac-------
A0A2K5YT59_BAK1-02      ttcggctaccg-------tctggcccta------cacgtctac-------
A0A2K5YT59_BAK1-03      ttcggctaccg-------tctggcccta------cacgtctac-------
A0A2K5YT59_BAK1-01      ttcggctaccg-------tctggcccta------cacgtctac-------
                        *  *    *          ****   *       *   * * *       

A0A2K5XKG3_BAX-04       -------------------------------caaggtgccc---gaactg
A0A2K5XKG3_BAX-03       -------------------------------caaggtgccc---gaactg
A0A2K5XKG3_BAX-01       -------------------------------caaggtgccc---gaactg
A0A2K5XKG3_BAX-02       -------------------------------caaggtgccc---gaactg
A0A2K5YX79_BOK-01       gcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctg
A0A2K5YIY6_BAK1-01      -cagcgc----ggcttgactggcttcctgggccaggtgacc---cgcttc
A0A2K5YIY6_BAK1-02      -cagcgc----ggcttgactggcttcctgggccaggtgacc---cgcttc
A0A2K5YT59_BAK1-02      -cagcac----ggcctgactggcttcctgggccaggtgacc---cgcttc
A0A2K5YT59_BAK1-03      -cagcac----ggcctga--------------------------------
A0A2K5YT59_BAK1-01      -cagcac----ggcctgactggcttcctgggccaggtgacc---cgcttc

A0A2K5XKG3_BAX-04       atcagaaccatcatggg-----------ctg-gacactggacttcct---
A0A2K5XKG3_BAX-03       atcagaaccatcatggg-----------ctg-gacactggacttcct---
A0A2K5XKG3_BAX-01       atcagaaccatcatggg-----------ctg-gacactggacttcct---
A0A2K5XKG3_BAX-02       atcagaaccatcatggg-----------ctg-gacactggacttcct---
A0A2K5YX79_BOK-01       gccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgt
A0A2K5YIY6_BAK1-01      gtggt---ctgcatg-------------ctgcaatactgcatcgcctggt
A0A2K5YIY6_BAK1-02      gtggt---ctgcatg-------------ctgcaatactgcatcgcctggt
A0A2K5YT59_BAK1-02      gtggtcgacttcatg-------------ctgcatcactgcattgcccggt
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      gtggtcgacttcatg-------------ctgcatcactgcattgcccggt

A0A2K5XKG3_BAX-04       ------ccgggagcggctgttgggctggatccaaga--------------
A0A2K5XKG3_BAX-03       ------ccgggagcggctgttgggctggatccaaga--------------
A0A2K5XKG3_BAX-01       ------ccgggagcggctgttgggctggatccaaga--------------
A0A2K5XKG3_BAX-02       ------ccgggagcggctgttgggctggatccaaga--------------
A0A2K5YX79_BOK-01       ggactgcctgggggagtttgtgcgcaagaccctggcaacctggctgcgga
A0A2K5YIY6_BAK1-01      ggatcgcgcagaggggcagctgggtggcagccctggacttgggcaatggt
A0A2K5YIY6_BAK1-02      ggatcgcgcagaggggcagctgggtggcagccctggacttgggcaatggt
A0A2K5YT59_BAK1-02      ggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggt
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      ggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggt

A0A2K5XKG3_BAX-04       -ccagggtggttgggtgagactcctcaaccctc-----------------
A0A2K5XKG3_BAX-03       -ccagggtggttgggacggcctcctc------t-----------------
A0A2K5XKG3_BAX-01       -ccagggtggttgggacggcctcctc------t-----------------
A0A2K5XKG3_BAX-02       -ccagggtggttgggacggcctcctc------t-----------------
A0A2K5YX79_BOK-01       gacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccct
A0A2K5YIY6_BAK1-01      cccatcctgaacatgctggtgattctgggggtg-----------------
A0A2K5YIY6_BAK1-02      cccatcctgaacatgctggtgattctgggggtg-----------------
A0A2K5YT59_BAK1-02      cccatcctgaacgtgctggtggttctgggtgtg-----------------
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      cccatcctgaacgtgctggtggttctgggtgtg-----------------

A0A2K5XKG3_BAX-04       --------ctcaccccaaccaccgcccctgccccactgtccctgcccacc
A0A2K5XKG3_BAX-03       --------cctactttgg--gacgcccacgtggca--gaccgtgacca-t
A0A2K5XKG3_BAX-01       --------cctactttgg--gacgcccacgtggca--gaccgtgacca-t
A0A2K5XKG3_BAX-02       --------cctactttgg--gacgcccacgtggca--gaccgtgacca-t
A0A2K5YX79_BOK-01       ggcctccgctcccactggctggtagccgcactctgcagcttcggccgctt
A0A2K5YIY6_BAK1-01      -----------------------------gttctg----ttgggcccgtt
A0A2K5YIY6_BAK1-02      -----------------------------gttctg----ttgggcccgtt
A0A2K5YT59_BAK1-02      -----------------------------gttctg----ttgggccagtt
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      -----------------------------gttctg----ttgggccagtt

A0A2K5XKG3_BAX-04       cccggtcacagtggtgccctctccccatctttggatcatcag-----atg
A0A2K5XKG3_BAX-03       cttggtggctggagtactcaccgcctccctc---accatctggaagaaga
A0A2K5XKG3_BAX-01       cttggtggctggagtactcaccgcctccctc---accatctggaagaaga
A0A2K5XKG3_BAX-02       cttggtggctggagtactcaccgcctccctc---accatctggaagaaga
A0A2K5YX79_BOK-01       cctgaaggctgccttcttcgt-------------gctgctgccagagaga
A0A2K5YIY6_BAK1-01      tgtggtacaaagattcttc-------------------------aaatca
A0A2K5YIY6_BAK1-02      tgtggtacaaagattcttc-------------------------aaatca
A0A2K5YT59_BAK1-02      tgtggtacgaagattcttc-------------------------aaatca
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      tgtggtacgaagattcttc-------------------------aaatca

A0A2K5XKG3_BAX-04       tggtctataatgcatttccttatgtgtct
A0A2K5XKG3_BAX-03       tgggctga---------------------
A0A2K5XKG3_BAX-01       tgggctga---------------------
A0A2K5XKG3_BAX-02       tgggctga---------------------
A0A2K5YX79_BOK-01       tga--------------------------
A0A2K5YIY6_BAK1-01      tga--------------------------
A0A2K5YIY6_BAK1-02      tga--------------------------
A0A2K5YT59_BAK1-02      tga--------------------------
A0A2K5YT59_BAK1-03      -----------------------------
A0A2K5YT59_BAK1-01      tga--------------------------

© 1998-2019