Dataset for CDS BAX of Organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5XKG3_BAX-04      atggacgggtccggggagcagcccagaggcggggg---gcccaccagctc
A0A2K5XKG3_BAX-03      atggacgggtccggggagcagcccagaggcgggggagtgacaccccgttc
A0A2K5XKG3_BAX-01      atggacgggtccggggagcagcccagaggcggggg---gcccaccagctc
A0A2K5XKG3_BAX-02      atggacgggtccggggagcagcccagaggcggggg---gcccaccagctc
                       ***********************************   * *  ** * **

A0A2K5XKG3_BAX-04      tgaacagatcatgaagacaggggcccttttgcttcagggtttcatccagg
A0A2K5XKG3_BAX-03      tga-----------------------ttctgcaccctcactccatcccca
A0A2K5XKG3_BAX-01      tgaacagatcatgaagacaggggcccttttgcttcagggtttcatccagg
A0A2K5XKG3_BAX-02      tgaacagatcatgaagacaggggcccttttgcttcagg------------
                       ***                       ** ***  *               

A0A2K5XKG3_BAX-04      atcgagcagggcgaatggggggggagacacccgagctggccctggacccg
A0A2K5XKG3_BAX-03      ctcta----ggcgaatggggggggagacacccgagctggccctggacccg
A0A2K5XKG3_BAX-01      atcgagcagggcgaatggggggggagacacccgagctggccctggacccg
A0A2K5XKG3_BAX-02      --------------------------------------------------

A0A2K5XKG3_BAX-04      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K5XKG3_BAX-03      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K5XKG3_BAX-01      gtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcat
A0A2K5XKG3_BAX-02      --------------------------------------------------

A0A2K5XKG3_BAX-04      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K5XKG3_BAX-03      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K5XKG3_BAX-01      cggggacgaactggacagtaacatggagctgcagaggatgattgccgccg
A0A2K5XKG3_BAX-02      -----------------------------------ggatgattgccgccg

A0A2K5XKG3_BAX-04      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K5XKG3_BAX-03      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K5XKG3_BAX-01      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg
A0A2K5XKG3_BAX-02      tggacacagactccccccgagaggtctttttccgagtggcagctgacatg

A0A2K5XKG3_BAX-04      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K5XKG3_BAX-03      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K5XKG3_BAX-01      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
A0A2K5XKG3_BAX-02      ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt

A0A2K5XKG3_BAX-04      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K5XKG3_BAX-03      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K5XKG3_BAX-01      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga
A0A2K5XKG3_BAX-02      tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactga

A0A2K5XKG3_BAX-04      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K5XKG3_BAX-03      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K5XKG3_BAX-01      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg
A0A2K5XKG3_BAX-02      tcagaaccatcatgggctggacactggacttcctccgggagcggctgttg

A0A2K5XKG3_BAX-04      ggctggatccaagaccagggtggttgggtgagactcctcaaccctcctca
A0A2K5XKG3_BAX-03      ggctggatccaagaccagggtggttgggacggcctcctc------tccta
A0A2K5XKG3_BAX-01      ggctggatccaagaccagggtggttgggacggcctcctc------tccta
A0A2K5XKG3_BAX-02      ggctggatccaagaccagggtggttgggacggcctcctc------tccta
                       ****************************   * ******       *  *

A0A2K5XKG3_BAX-04      ccccaaccaccgcccctgccccactgtccctgcccacccccggtcacagt
A0A2K5XKG3_BAX-03      ctttgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctgg
A0A2K5XKG3_BAX-01      ctttgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctgg
A0A2K5XKG3_BAX-02      ctttgg--gacgcccacgtggca--gaccgtgacca-tcttggtggctgg
                       *         *****  *   **  * ** ** ***  *  ***  * * 

A0A2K5XKG3_BAX-04      ggtgccctctccccatctttggatcatcag-----atgtggtctataatg
A0A2K5XKG3_BAX-03      agtactcaccgcctccctc---accatctggaagaagatgggctga----
A0A2K5XKG3_BAX-01      agtactcaccgcctccctc---accatctggaagaagatgggctga----
A0A2K5XKG3_BAX-02      agtactcaccgcctccctc---accatctggaagaagatgggctga----
                        ** * * *  **   **    * **** *     *  *** **      

A0A2K5XKG3_BAX-04      catttccttatgtgtct
A0A2K5XKG3_BAX-03      -----------------
A0A2K5XKG3_BAX-01      -----------------
A0A2K5XKG3_BAX-02      -----------------

© 1998-2019