Dataset for CDS BAK1 of Organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5YIY6_BAK1-02      atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagct
A0A2K5YIY6_BAK1-01      atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagct
A0A2K5YT59_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                                                                          

A0A2K5YIY6_BAK1-02      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2K5YIY6_BAK1-01      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2K5YT59_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K5YT59_BAK1-03      ----------------------gagcaggtagcccgggacacagaggagg
A0A2K5YT59_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                                              ********* *********  *** ** 

A0A2K5YIY6_BAK1-02      --------------gtttttgaccgccatcagcaggaacaggaggctgaa
A0A2K5YIY6_BAK1-01      --------------gtttttgaccgccatcagcaggaacaggaggctgaa
A0A2K5YT59_BAK1-02      ttttccgcagctacgttttttaccgccatcagcagaacc-----------
A0A2K5YT59_BAK1-03      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K5YT59_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                                      ****** ************** * *           

A0A2K5YIY6_BAK1-02      gg------------------------------------------------
A0A2K5YIY6_BAK1-01      gggccagccgcccctgccgacccagagatggtcacctt------------
A0A2K5YT59_BAK1-02      ---------------------------------------cctctgccac-
A0A2K5YT59_BAK1-03      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
A0A2K5YT59_BAK1-01      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
                                                                          

A0A2K5YIY6_BAK1-02      ---cagcaccgtggggcaggtgggacggcggatc----------------
A0A2K5YIY6_BAK1-01      ---cagcaccgtggggcaggtgggacggcggatc----------------
A0A2K5YT59_BAK1-02      -----gagcca-aggcctggtgggacggcagctcgccatcatcggggacg
A0A2K5YT59_BAK1-03      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
A0A2K5YT59_BAK1-01      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
                             *  **   ** * *********** * **                

A0A2K5YIY6_BAK1-02      --------------------------------accatgctgcaccacctg
A0A2K5YIY6_BAK1-01      --------------------------------accatgctgcaccacctg
A0A2K5YT59_BAK1-02      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
A0A2K5YT59_BAK1-03      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
A0A2K5YT59_BAK1-01      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
                                                        *********** ** ***

A0A2K5YIY6_BAK1-02      cagcccacagcagagaacgcctacgagtacttcaccaagatcgcctc---
A0A2K5YIY6_BAK1-01      cagcccacagcagagaacgcctacgagtacttcaccaagatcgcctc---
A0A2K5YT59_BAK1-02      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
A0A2K5YT59_BAK1-03      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctccag
A0A2K5YT59_BAK1-01      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
                        ******** ************** ***************** *****   

A0A2K5YIY6_BAK1-02      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5YIY6_BAK1-01      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5YT59_BAK1-02      -----------------cagcctgtttgagagtggcatcaactggggccg
A0A2K5YT59_BAK1-03      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
A0A2K5YT59_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
                                         *************************  ******

A0A2K5YIY6_BAK1-02      tgtggtggctctcctgggcttcggctaccgtctggccctacatgtctacc
A0A2K5YIY6_BAK1-01      tgtggtggctctcctgggcttcggctaccgtctggccctacatgtctacc
A0A2K5YT59_BAK1-02      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
A0A2K5YT59_BAK1-03      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
A0A2K5YT59_BAK1-01      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
                        ************ ***************************** *******

A0A2K5YIY6_BAK1-02      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
A0A2K5YIY6_BAK1-01      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
A0A2K5YT59_BAK1-02      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
A0A2K5YT59_BAK1-03      agcacggcctga--------------------------------------
A0A2K5YT59_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
                        *** **** ***                                      

A0A2K5YIY6_BAK1-02      tgcatgctgcaatactgcatcgcctggtggatcgcgcagaggggcagctg
A0A2K5YIY6_BAK1-01      tgcatgctgcaatactgcatcgcctggtggatcgcgcagaggggcagctg
A0A2K5YT59_BAK1-02      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg
                                                                          

A0A2K5YIY6_BAK1-02      ggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtga
A0A2K5YIY6_BAK1-01      ggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtga
A0A2K5YT59_BAK1-02      ggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtgg
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      ggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtgg
                                                                          

A0A2K5YIY6_BAK1-02      ttctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaa
A0A2K5YIY6_BAK1-01      ttctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaa
A0A2K5YT59_BAK1-02      ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaa
A0A2K5YT59_BAK1-03      --------------------------------------------------
A0A2K5YT59_BAK1-01      ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaa
                                                                          

A0A2K5YIY6_BAK1-02      tcatga
A0A2K5YIY6_BAK1-01      tcatga
A0A2K5YT59_BAK1-02      tcatga
A0A2K5YT59_BAK1-03      ------
A0A2K5YT59_BAK1-01      tcatga
                              

© 1998-2018